Objective: Tourette syndrome (TS) is a childhood neurodevelopmental disorder caused by various genetic and environmental factors and presents with apparent genetic heterogeneity. As ASH1L potentially contributes to neurodevelopmental diseases, especially in TS, we aim to investigate the susceptibility of ASH1L on TS in the Chinese Han population.Methods: Three tag single nucleotide polymorphisms (SNPs) (rs5005770, rs12734374, and rs35615695) in ASH1L were screened in 271 TS nuclear family trios and 337 healthy subjects by the TaqMan assays real time. A case-control study combined with family-based analysis was applied to study the genetic susceptibility of common variants of ASH1L.
Results:The results revealed a significant over-transmission of rs35615695 and rs5005770 (for rs35615695, transmission disequilibrium test, χ 2 = 57.375, p = .000, HHRR, χ 2 = 4.807, p = .028; for rs5005770, HRR, χ 2 = 4.116, p = .042, HHRR, χ 2 = 8.223, p = .004) in family-based study. Furthermore, rs5005770 and rs35615695 still remained significant after Bonferroni correction (p < .017). However, the two SNPs (rs5005770 and rs35615695) were found not to be associated with TS in case-control study.
Conclusions:Our study suggests that ASH1L may contribute to TS susceptibility in the Han Chinese population and involved in TS development as a risk factor.
Limb weakness is an uncommon symptom in children, with multiple
factors contributing to related diseases, particularly genetic
disorders. A nine-year-old boy presented with slowly progressive muscle
weakness of the limb-girdle muscles. We evaluated the clinical symptoms,
laboratory tests, imaging examinations, and pathological examinations of
this proband. We combined whole-exome and Sanger sequencing to identify
the novel compound heterozygous pathogenic mutations NM 001849.3:
c.1970-10_1978 del CGGCTTGCAGGGACGCGTG and c.2462-3C>A in
COL6A2 in this proband inherited from the mother and father,
respectively. Mutational confirmation at the mRNA level demonstrated
that the proband carried a homozygous abnormal sequence with 23bp
deletions (c.2462-2484 del GGACGCGTGTGGGCGTGGTGCAG) at the beginning of
exon 26. In contrast, both parents and sibling have normal sequences
with no clinical symptoms. The results of this study further expand the
mutational spectrum and will be helpful for further molecular diagnosis.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.