Drugs may interact with double stranded DNA via a variety of binding modes, each mode giving rise to a specific pharmacological function. Here we demonstrate the ability of single molecule force spectroscopy to discriminate between different interaction modes by measuring the mechanical properties of DNA and their modulation upon the binding of small molecules. Due to the unique topology of double stranded DNA and due to its base pair stacking pattern, DNA undergoes several well-characterised structural transitions upon stretching. We show that small molecule binding markedly affects these transitions in ways characteristic to the binding mode and that these effects can be detected at the level of an individual molecule. The minor groove binder berenil, the crosslinker cisplatin and the intercalator ethidium bromide are compared. ß

The dynamic behaviour of DNA is of fundamental importance to many cellular processes. One principal characteristic, central to transcription and replication, is the ability of the duplex to "melt". It has recently been shown that dynamic force spectroscopy provides information about the energetics of biomolecular dissociation. We have employed this technique to investigate the unbinding of single dodecanucleotide molecules. To separate the duplex to single-stranded DNA, forces ranging from 17 to 40 pN were required over a range of loading rates. Interpretation of the dependence of melting force on loading rate revealed that the energy barrier to rupture is between 9 and 13 kcal mol-1 in height and situated 0.58 nm from an intermediate structural state. Thermal melting studies show that, prior to dissociation, the oligonucleotide underwent a transition which required between 7 and 11 kcal mol-1 in energy. Through combined dynamic force spectroscopy and thermal melting studies we show the derivation of an energy landscape to dissociate a 12-mer duplex. Until very recently, this type of information was only accessible by computational analysis. Additionally, the force spectroscopy data allow an estimation of the kinetics of duplex formation and melting.

Eukaryotic DNA is packaged into the cell nucleus as a nucleoprotein complex, chromatin. Despite this condensed state, access to the DNA sequence must occur during gene expression and other essential genetic events. Here we employ optical tweezers stretching of reconstituted chromatin fibers to investigate the release of DNA from its protein-bound structure. Analysis of fiber length increase per unbinding event revealed discrete values of approximately 30 and approximately 60 nm. Furthermore, a loading rate analysis of the disruption forces revealed three individual energy barriers. The heights of these barriers were found to be approximately 20 k(B)T, approximately 25 k(B)T, and approximately 28 k(B)T. For subsequent stretches of the fiber it was found that events corresponding to the approximately 28 k(B)T energy barrier were significantly reduced. No correlation between energy barrier crossed and DNA length release was found. These studies clearly demonstrate that optical tweezers stretching of chromatin provides insight into the energetic penalties imposed by chromatin structure. Furthermore these studies reveal possible pathways via which chromatin may be disrupted during genetic code access.

Chromatin entanglements undergo specific protein-mediated compaction to fold into mitotic chromosomes.

SummaryStructural transitions in the tertiary structure of plasmid DNA have been investigated using atomic force microscopy. Changes in superhelical stress were induced by ethidium bromide intercalation, and conformational effects monitored by recording topographic images from DNA complexes of various ethidium bromide : base pair stoichiometry. Significant changes in the tertiary structure of individual DNA molecules were observed with increasing ethidium bromide concentration. The first distinct conformational transition was from a predominantly relaxed structure to one consisting solely of toroidal supercoils. A further increase in ethidium bromide concentration resulted in the formation of regions of plectonemic supercoiling. The ratio of plectonemic : toroidal supercoiling gradually increased until an extremely tightly interwound structure of solely plectonemic supercoiling was finally adopted. The toroidal form of supercoiling observed in this study is unusual as both atomic force microscopy and electron microscopy techniques have previously shown that plectonemic supercoiling is the predominant form adopted by plasmid DNA.

The effect of nonspecific proteolysis on the structure of single isolated mitotic newt chromosomes was studied using chromosome elastic response as an assay. Exposure to either trypsin or proteinase K gradually decondensed and softened chromosomes but without entirely eliminating their elastic response. Analysis of chromosome morphology revealed anisotropic decondensation upon digestion, with length increasing more than width. Prolonged protease treatment resulted only in further swelling of the chromosome without complete dissolution. Mild trypsinization induced sensitivity of chromosome elasticity to five- and six-base-specific restriction enzymes. These results, combined with previous studies of effects of nucleases on mitotic chromosome structure, indicate that mild proteolysis gradually reduces the density of chromatin-constraining elements in the mitotic chromosome, providing evidence consistent with an anisotropically folded "chromatin network" model of mitotic chromosome architecture.

The detection of duplex formation for tethered films of 12-mer (d(CGCAAAAAAGCG)) and 34-mer ((d(GCGTTCATTGTGGTGATATGTGCGCAAAAAAGCG)) oligonucleotides and of subsequent small molecule (nogalamycin and berenil) binding is demonstrated using the quartz crystal microbalance (QCM) technique. The mass change sensitivity of the QCM technique is exploited to identify the binding of approximately two nogalamycin molecules per 12-mer duplex and seven nogalamycin molecules per 34-mer duplex. These data are consistent with previous reports of steric hindrance between nogalamycin molecules blocking simultaneous binding to closely spaced 5‘TpG and 5‘CpG sites. No consistent or significant shifts in frequency or dissipation were observed on exposure of the 12-mer or 34-mer films to berenil. This observation suggests that berenil binding has the net result of displacing a mass equivalent of 12−20 water molecules. The effect of packing within the 12-mer duplex films has been investigated, revealing interduplex separations at different surface concentrations of DNA and a minimum interduplex distance of 2.6 nm. The films formed from the 34-mer are demonstrated to increase energy dissipation in the oscillated film compared to that for the 12-mer, and this is proposed to result from increased duplex length and possibly interduplex entanglement. This conclusion is supported by a rise in dissipation observed as the 34-mer duplex length increases due to nogalamycin intercalation.

The structure of individual nucleosomes organized within reconstituted 208-12 arrays at different levels of compaction was examined by tapping mode atomic force microscopy in air and liquid. Reconstitution at lower histone octamer to DNA weight ratios showed an extended beads-on-a-string morphology with less than the expected maximum of 12 nucleosome core particles per array, each particle located in the most favored positioning site. A correlation of the contour lengths of these arrays with the number of observed particles revealed two distinct populations of particles, one with approximately 50 nm of bound DNA and a second population with approximately 25 nm. The measured nucleosome center-to-center distances indicate that this approximately 25 nm is not necessarily symmetrically bound about the dyad axis, but can also correspond to DNA bound from either the entry or exit point of the particle to a location at or close to the dyad axis. An assessment of particle heights suggests that particles wrapping approximately 25 nm of DNA are most likely to be subnucleosomal particles, which lack either one or both H2A-H2B dimers. At a higher reconstitution ratio, folded compact arrays fully populated with 12 nucleosome core particles, were observed. Liquid measurements demonstrated dynamic movements of DNA loops protruding from these folded arrays.