This paper aimed to analyze the association of polymorphism of GSTM1 0/0 genotype with laryngeal cancer along a hospital based case‐control study. Polymorphisms of GSTM1 0/0 of samples from 36 patients with laryngeal cancer and 35 healthy controls were detected by PCR method. The reaction used as GSTM1 primers, using the sequence sense: 5′‐CTGCCCTACTTGGATTGATGGG‐3′ and antisense: 5′‐TGGATTGTAGCAGATCATGC‐3′. N Acetyl transferase 1 (NAT1) gene using the primers sense: 5′‐TAAAAGTAAAATGATTTGCTTTCG‐3′ and antisense: 5′‐GCTTTCTAGCATAAATCACCAA‐3′ was used as internal positive control. Two sided 2 and multivariation analysis were used to analyse the results. The proportions of GSTM1 deleted genotype in cases and controls were 47.2% and 54.3%, respectively. There was significant increment of GSTM 0/0 genotype frequency in moderate smokers group of patients compared to control (P=0.033, OR= 4.78, 95% CI=1.30‐7.13). We conclude that GSTM1 deleted genotype may be a genetic susceptibility marker for laryngeal cancer whose exposed to low doses carcinogens. The absence of this enzyme seems to have a role in the development of laryngeal cancer, in which the mechanism still needs further investigation.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.