Sea buckthorn (Hippophae rhamnoides L.) is a native species in various regions of Asia and Europe. It is cultivated as a multipurpose horticultural species in northern temperate regions of Europe, Asia, and North America with large economic potential used for food, pharmacology, cosmetics, and environmental conservation. Diseases in natural populations and managed landscapes have increased, endangering sea buckthorn growth and cultivation worldwide. This review article focuses on sea buckthorn canker, wilt and decline diseases caused by pathogenic fungi, their distribution, hosts of involved pathogenic fungi and symptoms. Published information on sea buckthorn fungal diseases is available only about a few diseases, such as wilt (Verticillium dahliae), the dried-shrink disease caused by various fungi and abiotic factors, and stem canker (Hymenopleella hippophaeicola, Cytospora spp., Stigmina sp.). Some fungi reported on sea buckthorn are poorly studied, or the sea buckthorn is a newly discovered host, as in the case of Eutypa spp. The most often reported symptoms of these diseases are cankers and cracks on trunks and main branches, dead buds and leaves, necrosis of various tissues on branches, and root necrosis, resulting in the death of the shrubs. In general, the fungal diseases on sea buckthorn are not sufficiently addressed, and more research is needed.
Ribes are essential berry crops in the temperate zones in Eurasia and New Zealand, and viral infections are common constraints in their cultivation. Gooseberry vein banding associated virus (GVBaV) is vectored by aphids and has been reported from a few European countries and North America. Knowledge on how GVBaV interacts with its vectors on Ribes is still limited. The occurrence of GVBaV in cultivated and wild Ribes in various habitats was studied, focusing on germplasm collections, wild localities, home gardens and green spaces where chemical plant protection is not applied.GVBaV was confirmed for the first time in Latvia in all studied Ribes groups except Ribes×nidigrolaria, and in all habitats surveyed; however, its occurrence did not exceed 8%. Ribes alpinum and R. aureum were found as new naturally infected hosts. GVBaV was detectable in single aphid specimens by PCR and confirmed in Aphis schneideri, Cryptomyzus galeopsidis, Cryptomyzus ribis, Hyperomyzus lactucae and Nasonovia ribisnigri. Phylogenetic analyses did not reveal supported clustering related to host or geographic origin, except for GVBaV isolates in A. schneideri obtained from cultivated gooseberry. This is the first study contributing to the understanding of virus genetic diversity in its vector species in relation to the host plants. A. schneideri that feeds only on Ribes is probably a major contributor to GVBaV spread in comparison with other aphid species migrating to secondary hosts.
Blackcurrants (Ribes nigrum) are among the most important commercial berry crops in Latvia and, together with redcurrants and gooseberries, have a long history of local cultivation and breeding (Zuļģe et al. 2018). So far at least 20 viruses were reported to infect Ribes plants (Špak et al. 2021). Blackcurrant-associated rhabdovirus (BCaRV) was previously identified in USA by high throughput sequencing (HTS) of blackcurrant germplasm accession introduced from Russia (isolate Veloy) and now serves as an exemplar isolate for BCaRV (Wu et al. 2018). Presence of BCaRV was also confirmed by RT-PCR in blackcurrant germplasm accession of cv. Burga from France during the same study by Wu et al. (2018). Currently Blackcurrant betanucleorhabdovirus is one of the nine species recognized by ICTV in genus Betanucleorhabdovirus of family Rhabdoviridae, but the impact of BCaRV on the host still remains unknown. Leaf tissue from twelve asymptomatic blackcurrant cv. Mara Eglite plants that negatively tested for blackcurrant reversion virus from Dobele, Latvia (56°36'31.9"N, 23°18'13.6"E) was collected on May 17, 2019 and used for HTS study of local Ribes resistance genes. Total RNA from the leaf tissue of sampled plants was isolated following a method described by Kalinowska et al. (2012) with minor modifications. Briefly, RNeasy Plant Mini Kit (QIAGEN) was used with RLC lysis buffer being supplemented with 2% PVP and 1% β-mercaptoethanol. Plant rRNA was subsequently removed by a RiboMinus Plant Kit for RNA-Seq (Thermo Fisher Scientific (TFS)) prior to cDNA library construction. HTS libraries were prepared using MGIEasy RNA Directional Library Prep Set for 16 reactions (MGI), following a protocol for 150 bp pair-end reads. According to the manufacturers guidelines libraries were pooled, circularized and cleaned before being subjected to sequencing on DNBSEQ-G400 (MGI) using PE150 flow cell (MGI). The sequencing run yielded a total of 393660492 150 bp long read pairs. Reads were assembled into transcripts using rnaSPAdes v 3.13.1 (Bushmanova et al. 2019) and a 14424 base long contig with an average coverage of 684x was found to be 99.5% identical (14358/14432 identities and 8 gaps in the pairwise alignment) to the previously reported first complete genome of BCaRV (MF543022.1) using EMBOSS Needle (Madeira et al., 2019). This contig representing the genome of BCaRV isolate Mara Eglite, onto which 66768 of the raw reads could be mapped, was subsequently deposited at European Nucleotide Archive under accession number OU015520. All of the twelve individual samples were also tested for the presence of BCaRV by RT-PCR, using Verso cDNA Synthesis Kit with random hexamer primers (TFS) for first strand cDNA synthesis followed by PCR with N protein nested primers BCaRV-N-F (5’ AGATGTGCTTCATCGATGGCTAGTTCTGCT 3’) and BCaRV-N-R (5’ TGCATTCCCACGGGTTAGGAATACATTGGTACT 3’) resulting in a 243 bp long fragment for six of the samples. RT-PCR products from six BCaRV positive samples were directly sequenced by Sanger-based method using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) with BCaRV-N-F and BCaRV-N-R primers. Acquired RT-PCR product sequences matched the corresponding region of BCaRV isolate Mara Eglite genome assembled from HTS data. In this report, we have documented the natural occurrence of BCaRV in Latvia, which makes it a second evidence on the presence of BCaRV in Europe.
The reported ultrasonic velocity measurements have been performed using a device in which the transmitter and the detector of sound vibrations are rigidly mounted at a constant distance from each other to avoid statistical errors at measuring the distance travelled by acoustic waves. The accuracy of measurements was thus dependent only on the resolution of the device determined by the frequency of time reference signals, its stability, the travelled distance, and the sound velocity.The velocities measured in six objects exhibit a common behaviour with time, reaching a maximum between the 9-th and 33-rd hour after complete disruption in the blood supply and remaining higher compared with the initial value at least for 80 h after disruption. The obtained values of sound velocity are consistent with the results found by other authors, while the rise after disruption in the blood supply -with the increase in elasticity of the bone tissue.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.