Uniformly 32P-labeled bacteriophage T5 leucine tRNA has been isolated by two-dimensional gel electrophoresis from phage-infected E. coli cells. Its nucleotide sequence has been determined by conventional techniques using TLC on cellulose for oligonucleotide fractionation: pGGGGCUAUGCUGGAACDGmGDAGACAAUACGGCCUUAGm6AU psi CCGUAGCUUAAAUGCGUGGGAGT psi CGAGUCUCCCUAGCCCCACCAoh. This tRNA has anticodon sequence UAG, which can presumably recognize all the four leucine-specific codons (CUN). The main feature of T5 tRNALeu is the absence of the A10-C25 and C31-psi 39 pairing in the D and anticodon stems, respectively.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.