Type 2 diabetes mellitus (DM) has reached pandemic proportions and effective prevention strategies are wanted. Its onset is accompanied by cellular distress, the nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor boosting cytoprotective responses, and many phytochemicals activate Nrf2 signaling. Thus, Nrf2 activation by natural products could presumably alleviate DM. We summarize function, regulation and exogenous activation of Nrf2, as well as diabetes-linked and Nrf2-susceptible forms of cellular stress. The reported amelioration of insulin resistance, β-cell dysfunction and diabetic complications by activated Nrf2 as well as the status quo of Nrf2 in precision medicine for DM are reviewed.
The transcription factor Nrf2 (nuclear factor (erythroid-derived 2)-like 2) and the kinase AMPK (AMP-activated protein kinase) participate in the cellular adaptive response to redox or energy stress. Despite accumulating evidence for positive cooperativity between both proteins, information about direct post-translational modification of Nrf2 by AMPK in living cells is scarce. Here, MS-based analysis of immunoprecipitated Nrf2 revealed serine 374, 408 and 433 in human Nrf2 to be hyperphosphorylated as a function of activated AMPK. A direct phosphate-transfer by AMPK to those sites was indicated by in vitro kinase assays with recombinant proteins as well as interaction of AMPK and Nrf2 in cells, evident by co-immunoprecipitation. Mutation of serine 374, 408 and 433 to alanine did not markedly affect half-life, nuclear accumulation or induction of reporter gene expression upon Nrf2 activation with sulforaphane. However, some selected endogenous Nrf2 target genes responded with decreased induction when the identified phosphosites were mutated, whereas others remained unaffected. Notably, the genes susceptible to the mutation of the phosphorylation sites in Nrf2 consistently showed reduced induction in AMPKα1 −/−cells. Overall, our data reveal AMPK-triggered phosphorylation of Nrf2 at three serine residues, apparently determining the extent of transactivation of selected target genes.
Audencel is a dendritic cell (DC)-based cellular cancer immunotherapy against glioblastoma multiforme (GBM). It is characterized by loading of DCs with autologous whole tumor lysate and in vitro maturation via “danger signals”. The recent phase II “GBM-Vax” trial showed no clinical efficacy for Audencel as assessed with progression-free and overall survival in all patients. Here we present immunological research accompanying the trial with a focus on immune system factors related to outcome and Audencel’s effect on the immune system. Methodologically, peripheral blood samples (from apheresis before Audencel or venipuncture during Audencel) were subjected to functional characterization via enzyme-linked immunospot (ELISPOT) assays connected with cytokine bead assays (CBAs) as well as phenotypical characterization via flow cytometry and mRNA quantification. GBM tissue samples (from surgery) were subjected to T cell receptor sequencing and immunohistochemistry. As results we found: Patients with favorable pre-existing anti-tumor characteristics lived longer under Audencel than Audencel patients without them. Pre-vaccination blood CD8+ T cell count and ELISPOT Granzyme B production capacity in vitro upon tumor antigen exposure were significantly correlated with overall survival. Despite Audencel’s general failure to induce a significant clinical response, it nevertheless seemed to have an effect on the immune system. For instance, Audencel led to a significant up-regulation of the Th1-related immunovariables ELISPOT IFNγ, the transcription factor T-bet in the blood and ELISPOT IL-2 in a dose-dependent manner upon vaccination. Post-vaccination levels of ELISPOT IFNγ and CD8+ cells in the blood were indicative of a significantly better survival. In summary, Audencel failed to reach an improvement of survival in the recent phase II clinical trial. No clinical efficacy was registered. Our concomitant immunological work presented here indicates that outcome under Audencel was influenced by the state of the immune system. On the other hand, Audencel also seemed to have stimulated the immune system. Overall, these immunological considerations suggest that DC immunotherapy against glioblastoma should be studied further – with the goal of translating an apparent immunological response into a clinical response. Future research should concentrate on investigating augmentation of immune reactions through combination therapies or on developing meaningful biomarkers.Electronic supplementary materialThe online version of this article (10.1186/s40478-018-0621-2) contains supplementary material, which is available to authorized users.
Glioblastoma is the most dangerous brain cancer. One reason for glioblastoma's aggressiveness are glioblastoma stem‐like cells. To target them, a number of markers have been proposed (CD133, CD44, CD15, A2B5, CD36, CXCR4, IL6R, L1CAM, and ITGA6). A comprehensive study of co‐expression patterns of them has, however, not been performed so far. Here, we mapped the multidimensional co‐expression profile of these stemness‐associated molecules. Gliomaspheres – an established model of glioblastoma stem‐like cells – were used. Seven different gliomasphere systems were subjected to multicolor flow cytometry measuring the nine markers CD133, CD44, CD15, A2B5, CD36, CXCR4, IL6R, L1CAM, and ITGA6 all simultaneously based on a novel 9‐marker multicolor panel developed for this study. The viSNE dimensionality reduction algorithm was applied for analysis. All gliomaspheres were found to express at least five different glioblastoma stem‐like cell markers. Multi‐dimensional analysis showed that all studied gliomaspheres consistently harbored a cell population positive for the molecular signature CD44+/CD133+/ITGA6+/CD36+. Glioblastoma patients with an enrichment of this combination had a significantly worse survival outcome when analyzing the two largest available The Cancer Genome Atlas datasets (MIT/Harvard Affymetrix: P = 0.0015, University of North Carolina Agilent: P = 0.0322). In sum, we detected a previously unknown marker combination – demonstrating feasibility, usefulness, and importance of high‐dimensional gliomasphere marker combinatorics.
The large difference in phenotypes among tumour populations may stem from the stochastic origin of tumours from distinct cells – tumour cells are assumed to retain the phenotypes of the cells from which they derive. Yet, functional studies addressing the cellular origin of leukaemia are lacking. Here we show that the cells of origin of both, BCR/ABL-induced chronic myeloid (CML) and B-cell acute lymphoid leukaemia (B-ALL), resemble long-term haematopoietic stem cells (LT-HSCs). During disease-maintenance, CML LT-HSCs persist to function as cancer stem cells (CSCs) that maintain leukaemia and require signalling by the transcription factor STAT5. In contrast, B-ALL LT-HSCs differentiate into CSCs that correspond to pro-B cells. This transition step requires a transient IL-7 signal and is lost in IL-7Rα-deficient cells. Thus, in BCR/ABLp185+ B-ALL and BCR/ABLp210+ CML, the final phenotype of the tumour as well as the abundance of CSCs is dictated by diverging differentiation fates of their common cells of origin.
© F e r r a t a S t o r t i F o u n d a t i o nhematopoiesis has revealed that HSCs express C/EBPα. 16To the best of our knowledge, there is no available mouse model for tracing myeloid cells without concurrent labeling of HSCs and lymphoid cells. Lactotransferrin (LTF, LF, CSP82) is well known as an iron-binding protein in the milk, saliva and mucosal secretions of the trachea, uterus and ovaries and has been implicated in innate immune responses against microbial infections.17,18 Ltf knockout mice have normal iron homeostasis and show no gross abnormalities with respect to terminal differentiation into hematopoietic lineages. 19 However, LTF exerts various immunomodulatory effects in monocytes, macrophages and neutrophils 17 and may affect myelopoiesis. 20,21 A membrane-bound form of LTF (CSP82) has been implicated in regulating dendritic development in vitro and in vivo. 22 In a search for myeloid-specific markers that are absent from HSCs, lymphoid and erythroid cells, we analyzed the expression pattern of Ltf during hematopoietic development.Here, we show that Ltf is specifically expressed in Gr-1 + /CD11b + bone marrow (BM) cells. To delineate the cellular compartments derived from Ltf + progenitors during hematopoietic development in vivo, we employed a lineage-tracing mouse model expressing Cre recombinase under the control of the Ltf-promoter, together with the irreversibly Cre-inducible tandem-dimer red fluorescent protein (tdRFP). 23 We show the Ltf-reporter + cells give rise to populations of dendritic cells (DCs), monocytes, macrophages and neutrophils, while sparing eosinophils, T cells, B cells, natural killer (NK) cells and erythrocytes. Methods MiceAll mice were kept under specific pathogen-free conditions at the University of Veterinary Medicine Vienna and the Research Institute of Molecular Pathology. Animal experiments were discussed and approved by the institutional ethics committees and were performed in accordance with Austrian law (BMWF-68.205/0243-II/3b/2011 and 66.009/0065-II/10b/2009). Generation of B6;129Sv-Tg(Ltf-iCre)14 transgenic miceA codon-improved Cre (iCre) recombinase was inserted into a bacterial artificial chromosome carrying the Ltf gene (BAC; RP24-166N8; purchased from Children's Hospital Oakland Research Institute, Oakland, CA, USA) via homologous recombination in E. coli. A cassette containing the iCre recombinase, an artificial intron, a bovine growth hormone polyadenylation signal and an ampicillin-resistance gene flanked by Frt (Flp recombinase target) sites, was recombined into the first exon of the Ltf gene. To delete the ampicillin gene, a plasmid expressing FLP recombinase was transfected into E. coli harboring the recombined BAC. Correct insertion and amp R -gene deletion were verified by Southern blotting and by DNA sequencing. BAC was purified using a CsCl-gradient and ultracentrifugation and injected into the pro-nuclei of B6/129SvF1 oocytes. Genotyping of B6;129Sv-Tg(Ltf-iCre)14 (Ltf-Cre + ) mice was performed with primers GGAAGCTGGCCTCTAAGAAC (forwa...
Glioblastoma is the most prevalent and aggressive brain cancer. With a median overall survival of ~15–20 months under standard therapy, novel treatment approaches are desperately needed. A recent phase II clinical trial with a personalized immunotherapy based on tumor lysate-charged dendritic cell (DC) vaccination, however, failed to prolong survival. Here, we investigated tumor tissue from trial patients to explore glioblastoma survival-related factors. We followed an innovative approach of combining mass spectrometry-based quantitative proteomics (n = 36) with microRNA sequencing plus RT-qPCR (n = 38). Protein quantification identified, e.g., huntingtin interacting protein 1 (HIP1), retinol-binding protein 1 (RBP1), ferritin heavy chain (FTH1) and focal adhesion kinase 2 (FAK2) as factor candidates correlated with a dismal prognosis. MicroRNA analysis identified miR-216b, miR-216a, miR-708 and let-7i as molecules potentially associated with favorable tissue characteristics as they were enriched in patients with a comparably longer survival. To illustrate the utility of integrated miRNomics and proteomics findings, focal adhesion was studied further as one example for a pathway of potential general interest.Taken together, we here mapped possible drivers of glioblastoma outcome under immunotherapy in one of the largest DC vaccination tissue analysis cohorts so far—demonstrating usefulness and feasibility of combined proteomics/miRNomics approaches. Future research should investigate agents that sensitize glioblastoma to (immuno)therapy—potentially building on insights generated here.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.