The recent Zika pandemic in the Americas is linked to congenital birth defects and Guillain-Barré syndrome. White blood cells (WBCs) play an important role in host immune responses early in arboviral infection. Infected WBCs can also function as ‘Trojan horses’ and carry viruses into immune-sheltered spaces, including the placenta, testes and brain. Therefore, defining which WBCs are permissive to Zika virus (ZIKV) is critical. Here, we analyse ZIKV infectivity of peripheral blood mononuclear cells (PBMCs) in vitro and from Nicaraguan Zika patients and show CD14+CD16+ monocytes are the main target of infection, with ZIKV replication detected in some dendritic cells. The frequency of CD14+ monocytes was significantly decreased, while the CD14+CD16+ monocyte population was significantly expanded during ZIKV infection compared to uninfected controls. Viral RNA was detected in PBMCs from all patients, but in serum from only a subset, suggesting PBMCs may be a reservoir for ZIKV. In Zika patients, the frequency of infected cells was lower but the percentage of infected CD14+CD16+ monocytes was significantly higher compared to dengue cases. The gene expression profile in monocytes isolated from ZIKV- and dengue virus-infected patients was comparable, except for significant differences in interferon-γ, CXCL12, XCL1, interleukin-6 and interleukin-10 levels. Thus, our study provides a detailed picture of the innate immune profile of ZIKV infection and highlights the important role of monocytes, and CD14+CD16+ monocytes in particular.

BackgroundDengue fever results from infection with one or more of four different serotypes of dengue virus (DENV). Despite the widespread nature of this infection, available molecular diagnostics have significant limitations. The aim of this study was to develop a multiplex, real-time, reverse transcriptase-PCR (rRT-PCR) for the detection, quantitation, and serotyping of dengue viruses in a single reaction.Methodology/Principal FindingsAn rRT-PCR assay targeting the 5′ untranslated region and capsid gene of the DENV genome was designed using molecular beacons to provide serotype specificity. Using reference DENV strains, the assay was linear from 7.0 to 1.0 log10 cDNA equivalents/µL for each serotype. The lower limit of detection using genomic RNA was 0.3, 13.8, 0.8, and 12.4 cDNA equivalents/µL for serotypes 1–4, respectively, which was 6- to 275-fold more analytically sensitive than a widely used hemi-nested RT-PCR. Using samples from Nicaragua collected within the first five days of illness, the multiplex rRT-PCR was positive in 100% (69/69) of specimens that were positive by the hemi-nested assay, with full serotype agreement. Furthermore, the multiplex rRT-PCR detected DENV RNA in 97.2% (35/36) of specimens from Sri Lanka positive for anti-DENV IgM antibodies compared to just 44.4% (16/36) by the hemi-nested RT-PCR. No amplification was observed in 80 clinical samples sent for routine quantitative hepatitis C virus testing or when genomic RNA from other flaviviruses was tested.Conclusions/SignificanceThis single-reaction, quantitative, multiplex rRT-PCR for DENV serotyping demonstrates superior analytical and clinical performance, as well as simpler workflow compared to the hemi-nested RT-PCR reference. In particular, this multiplex rRT-PCR detects viral RNA and provides serotype information in specimens collected more than five days after fever onset and from patients who had already developed anti-DENV IgM antibodies. The implementation of this assay in dengue-endemic areas has the potential to improve both dengue diagnosis and epidemiologic surveillance.

24Zika virus (ZIKV) is a mosquito-borne flavivirus that is responsible for recent explosive 25 epidemics in the Americas. Notably, ZIKV infection during pregnancy has been found to cause 26 congenital birth defects, including microcephaly, and ZIKV has been associated with Guillain

A number of diagnostic tests are available for dengue virus (DENV) detection, including a variety of nucleic acid amplification tests (NAATs). However, reports describing a direct comparison of different NAATs have been limited. In this study, we report the design of an internally controlled real-time reverse transcriptase PCR (rRT-PCR) that detects all four DENV serotypes but does not distinguish between them (the pan-DENV assay). Two hundred clinical samples were then tested using four different DENV RT-PCR assays: the pan-DENV assay, a commercially produced, internally controlled DENV rRT-PCR (the Altona assay), a widely used heminested RT-PCR, and a serotype-specific multiplex rRT-PCR assay. The pan-DENV assay had a linear range extending from 1.0 to 7.0 log 10 cDNA equivalents/l and a lower limit of 95% detection ranging from 1.7 to 7.6 cDNA equivalents/l, depending on the serotype. When measured against a composite reference standard, the pan-DENV assay proved to be more clinically sensitive than either the Altona or heminested assays, with a sensitivity of 98.0% compared to 72.3% and 78.8%, respectively (P < 0.0001 for both comparisons). The pan-DENV assay detected DENV in significantly more samples collected on or after day 5 of illness and in a subgroup of patients with detectable anti-DENV IgM at presentation. No significant difference in sensitivity was observed between the pan-DENV assay and the multiplex rRT-PCR, despite the presence of an internal control in the former. The detection of DENV RNA late in the course of clinical illness should serve to lengthen the period during which a confirmed molecular diagnosis of DENV infection can be provided. Dengue virus (DENV) is the most common vector-borne human viral pathogen worldwide (1). Infection with one or more of the four closely related virus serotypes (designated DENV-1 to -4) results in a range of clinical manifestations spanning asymptomatic infection, dengue fever (DF), and severe dengue, a category that includes entities previously classified as dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS) (1, 2). Infection with one serotype (primary infection) results in immunity to that serotype, but infection can still occur with any of the remaining serotypes (secondary infection). Secondary DENV infection has been shown to be a significant risk factor for the development of DHF or DSS (3, 4). DENV transmission largely occurs in the tropical and subtropical regions of the world, though the number of countries where DENV is endemic has been increasing (1, 5). Recent reports estimate that 230 million DENV infections occur annually worldwide, including 2 million cases of severe disease and 21,000 deaths (6). Over 3.6 billion people live in regions where this pathogen is endemic and are at risk for infection (6). DF is also one of the most common causes of a systemic febrile illness in travelers returning from countries where the virus is endemic and remains a major concern for military personnel stationed in these areas (7-9).A wide array o...

Infection with one or more of four related serotypes of dengue virus (designated DENV-1 to -4) results in a range of clinical manifestations, spanning asymptomatic infection, dengue fever (DF), and severe dengue (1). The signs and symptoms of dengue overlap significantly with those of other systemic febrile illnesses in the tropics, and diagnosis therefore rests on specific laboratory tests (2).The CDC DENV-1-4 real-time PCR is the first RT-PCR assay approved for DENV detection (3). Experiments performed during FDA approval showed that this assay compared favorably to envelope (E) gene sequencing and anti-DENV IgM seroconversion when samples collected within the first 5 days of illness onset were tested (3). However, a comparison with another real-time RT-PCR (rRT-PCR) assay was not reported.In this study, we compared a laboratory-developed DENV multiplex rRT-PCR with the CDC DENV-1-4 assay using 199 clinical samples collected from suspected dengue cases between day 2 and 9 of illness.The DENV multiplex rRT-PCR was performed as previously described (4) with the following modifications. (i) A redesigned FAM-labeled molecular beacon probe (CGCGATCTTCAGCATA TTGAAAGACGGTCGGATCGCG) was used. (ii) Cycling conditions were the following: 52°C for 15 min (RT step); 94°C for 2 min; 45 cycles of 94°C for 15 s, 55°C for 40 s, and 68°C for 20 s. (iii) DENV-2 and DENV-4 primers were used at final concentrations of 350 nM and 400 nM, respectively. The analytical performance of this assay was equivalent to that of the original DENV multiplex rRT-PCR, though cross-reactions in the green channel (DENV-1) were eliminated (data not shown) (4).The CDC DENV-1-4 real-time RT-PCR kit was obtained from the CDC Dengue Branch. The assay was performed in multiplex on the Rotor-Gene Q instrument as described in the package insert.A total of 199 precollected and deidentified clinical samples from Nicaragua (n ϭ 160) and Sri Lanka (n ϭ 39) were tested using both the DENV multiplex rRT-PCR and the CDC DENV-1-4 assay. These clinical samples were described previously (5). Briefly, the Nicaraguan samples were collected between 23 September 2008 and 23 December 2011 as part of the Nicaraguan Pediatric Dengue Cohort Study as well as a hospital-based study to assess risk factors for severe dengue. Samples were collected at presentation from 141 patients. Ten patients from the hospitalbased study had serial samples drawn on day 5 of illness (the day of presentation), day 6 (n ϭ 9), and day 7 (n ϭ 10). Samples were also collected from 39 children on presentation to the Lady Ridgeway Hospital (Colombo, Sri Lanka) with an acute febrile illness, clinically suspected to be dengue. These samples were collected between 18 March and 28 May 2012.Results obtained using the DENV multiplex and CDC DENV-1-4 assays were compared with each other and with a composite reference standard (Table 1). This standard incorporated the results from the present study with the results of previous testing using a heminested RT-PCR (6) and a laboratory-developed pan-DENV rRT-PCR...

Graphical AbstractHighlights d soxB1-2-deficient planarians exhibit movement defects and abnormal sensory function d Ectodermal-lineage progenitor cells express soxB1-2 d soxB1-2 activity is required for differentiation and function of sensory neurons d Inhibition of genes downstream of soxB1-2 recapitulates sensory regeneration defects SUMMARY SoxB1 genes play fundamental roles in neurodevelopmental processes and maintaining stem cell multipotency, but little is known about their function in regeneration. We addressed this question by analyzing the activity of the SoxB1 homolog soxB1-2 in the planarian Schmidtea mediterranea.Expression and functional analysis revealed that soxB1-2 marks ectodermal-lineage progenitors, and its activity is required for differentiation of subsets of ciliated epidermal and neuronal cells. Moreover, we show that inhibiting soxB1-2 or its candidate target genes leads to abnormal sensory neuron regeneration that causes planarians to display seizure-like movements or phenotypes associated with the loss of sensory modalities. Our analyses highlight soxB1-2-regulated genes that are expressed in sensory neurons and are homologous to factors implicated in epileptic disorders in humans and animal models of epilepsy, indicating that planarians can serve as a complementary model to investigate genetic causes of epilepsy.

Primary health care providers should use culturally appropriate strategies to better inform women about the importance of mammography screening and the limitations of BSE for preventing advanced breast cancer.

The intensity of transmission and severity of clinical presentation varied between the 2 epidemics, with higher transmission intensity associated with greater disease severity.