We consider in this paper a combinatorial problem we propose to solve with a constraint satisfaction method well deÿned at the beginning of the real game of life: this problem consists in extracting from the classical degenerate genetic code made of 64 triplets, a non-degenerate cyclic code made of 22 triplets, which we call the cyclic AB code. It is made up of the following chain: AUGGUGCCAUUCAAGACUAUGA, where the letters A, U, C, G represent the classical symbols of the (purine and pyrimidine) bases of the genetic code. The chain in a circular form presents the following features:(1) It begins with the initiation codon AUG and ends with the termination codon UGA. When it is in cyclic form, it can be read triplet after triplet by choosing one and only one representative of each synonymy class in the classical degenerate genetic code. The chain, therefore, possesses one and only one codon for each amino-acid. (2) Except for the pair CG, the chain contains the 15 other possible pairs of bases which start the triplets (satisfying the classical "wobble" hypothesis).(3) It corresponds to the major part of the loops of the present Oenothera Gly-tRNA.(4) It contains the most frequent triplets, but not the most rare ones, appearing in the genome of numerous species.This structure, also found in the loops part of the tRNAs, contains an excess of A, U bases with respect to G, C bases, like in the present tRNAs. More, its 3D structure has strong similarities with a precise part of the 3D shape of the present tRNAs. Therefore, we propose the cyclic AB code, solution of a realistic constraint satisfaction problem, as a primitive genetic structure which presents the essential coding properties of the present * Corresponding author.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.