Pese a deficiencias en el funcionamiento y a su falta de ambición económica, la creación del programa Ibermedia ha sido un punto de inflexión para crear un espacio audiovisual común para la región iberoamericana. A través de un fondo financiero multilateral, el programa ha intentado estimular la coproducción de productos para el cine y la televisión, el montaje inicial de proyectos cinematográficos, la distribución de películas dentro del mercado regional y la formación de recursos humanos para la industria audiovisual. Realizar una primera evaluación exhaustiva de sus primeros años de funcionamiento (1998–2007), analizar las opiniones que se han vertido sobre el mismo, así como realizar una primera valoración de su impacto en la región es el objetivo central de este trabajo.
Supplementary Table 1. Primers used in this thesis.
Primer namePrimer sequence (5'→3')PtaHMGB2/3_miR-a_2P AAAAGCGTGCTAGCGCATTTTTAGGGTA GAGCCAAAACAAG PtaHMGB2/3_miR*-s_3P AAAAACGTGCTAGCGGATTTTTTGGATG GAGCTACTAACAG
The purpose of is article is to examine the relationship between presidents' leadership styles and peace policies in the Colombian armed conflict. To do so, this study analyzes the peace policies and styles of Colombia's presidents from 1982 to 2017. The structure of this article is as follows: an examination of the literature on leadership styles and peace policies in turbulent conflicts and a definition of the theoretical framework; a review of the historical-biographical context; a description of the methodology, specifically an explanation of the content analysis employed to measure leadership styles; an analysis of the peace policies adopted in Colombia and conditions related to the personality of the political leaders that might explain them; and the conclusions. It will be argued that the adoption of those peace policies that resulted in the demobilization of insurgent groups in Colombia depended not only on structural, situational, and organizational factors but also on factors related to the personality of political leaders.
Public Significance StatementThis article argues that the adoption of the peace policies that resulted in the demobilization of insurgent groups in Colombia depended not only on structural, situational, or organizational factors, but also on factors related to the personality of the presidential leaders. Analysis of discourses by political leaders can offer valuable information about the opportunities and disadvantages of such decisions made to solve conflicts.
This introduction explores the relationship between Law and Political Correctness (PC), considering different stages (from culture wars on campus to narrative outsider jurisprudences), as well as diverse (contextually instable and often contradictory) narrative webs. This reflective path opens three main different problems: the first concerns the way how the sensitivity to political correctness is programmatically (contingently) pursued through statutory law; the second identifies the difficulties which plurality and fragmentation create, when we consider Law’s vocation for comparability; the third denounces specific institutionalizing procedures and social effects associable to the culture of political correctness. Acknowledging that the integrated discussion of these themes, in their juridical systematic implications, is fundamentally encore à faire, the last part of the text introduces in detail the seven chapters which follow, highlighting the stimulant plurality of perspectives and approaches which they manifest.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.