The spirochetal bacterium Borrelia miyamotoi is a human pathogen and has been identified in many countries throughout the world. This study reports for the first time the presence of Borrelia miyamotoi in Ireland, and confirms prior work with the detection of B . garinii and B . valaisiana infected tick s . Questing Ixodes ricinus nymph samples were taken at six localities within Ireland. DNA extraction followed by Sanger sequencing was used to identify the species and strains present in each tick. The overall rate of borrelial infection in the Irish tick population was 5%, with a range from 2% to 12% depending on the locations of tick collection. The most prevalent species detected was B . garinii (70%) followed by B . valaisiana (20%) and B . miyamotoi (10%). Knowledge of Borrelia species prevalence is important and will guide appropriate selection of antigens for serology test kit manufacture, help define the risk of infection, and allow medical authorities to formulate appropriate strategies and guidelines for diagnosis and treatment of Borrelia diseases.

Lyme disease, initially described as Lyme arthritis, was reported before nucleic-acid based detection technologies were available. The most widely used diagnostic tests for Lyme disease are based on the serologic detection of antibodies produced against antigens derived from a single strain of Borrelia burgdorferi. The poor diagnostic accuracy of serological tests early in the infection process has been noted most recently in the 2018 Report to Congress issued by the U.S. Department of Health and Human Services Tick-Borne Disease Working Group. Clinical Lyme disease may be caused by a diversity of borreliae, including those classified as relapsing fever species, in the United States and in Europe. It is widely accepted that antibiotic treatment of Lyme disease is most successful during this critical early stage of infection. While genomic sequencing is recognized as an irrefutable direct detection method for laboratory diagnosis of Lyme borreliosis, development of a molecular diagnostic tool for all clinical forms of borreliosis is challenging because a “core genome” shared by all pathogenic borreliae has not yet been identified. After a diligent search of the GenBank database, we identified two highly conserved segments of DNA sequence among the borrelial 16S rRNA genes. We further developed a pair of Borrelia genus-specific PCR primers for amplification of a segment of borrelial 16S rRNA gene as a “core genome” to be used as the template for routine Sanger sequencing-based metagenomic direct detection test. This study presented examples of base-calling DNA sequencing electropherograms routinely generated in a clinical diagnostic laboratory on DNA extracts of human blood specimens and ticks collected from human skin bites and from the environment. Since some of the tick samples tested were collected in Ireland, borrelial species or strains not known to exist in the United States were also detected by analysis of this 16S rRNA “core genome”. We recommend that hospital laboratories located in Lyme disease endemic areas begin to use a “core genome” sequencing test to routinely diagnose spirochetemia caused by various species of borreliae for timely management of patients at the early stage of infection.

29 Lyme borreliosis is a systemic infection caused by tick-borne pathogenic borreliae of the 30 Borrelia burgdorferi sensu lato complex or of the more heterogeneous relapsing fever borrelia 31 group. Clinical distinction of the infections due to different borrelia species is difficult. Accurate 32 knowledge of the prevalence and the species of borreliae in the infected ticks in the endemic 33 areas is valuable for formulating appropriate guidelines for proper management of this infectious 34 disease. The purpose of this research was to design a readily implementable protocol to detect 35 the divergent species of borreliae known to exist in Europe, using Irish samples of Ixodes ricinus 36 64 manifestations resulting from host immune response to various spirochetal products or 65 components. However, if not treated early, within days to weeks, the borrelial spirochetes 66 disseminate from the site of the tick bite to other regions of the body [8]. 67Since Lyme borreliosis only occurs in the endemic areas where the tick population is infected 68 with pathogenic borrelial species, accurate surveys of the borrelial infections of the ticks 3 69 collected in the potential endemic areas can provide valuable information on the possible 70 existence of any of these Lyme and related borrelioses, and can serve as guidelines for selection 71 of the proper antigens for diagnostic serology tests which may be species-or even strain-specific 72 [9][10][11]. 73 In the past, the methods used for borrelial surveys were either designed to detect B. burgdorferi 74 sensu lato [1] or to detect B. miyamotoi [7, 12] in ticks; the PCR primers used for these 75 metagenomic assays were unable to amplify a conserved segment of DNA shared by all species 76 of borreliae. Only one study used a pair of general PCR primers which can amplify a segment of 77 16S rRNA gene of both B. burgdorferi sensu lato and B. miyamotoi for real-time PCR screening 78 [13]. But the interprimer DNA segment of the latter real-time PCR product is only 25 bp long 79 which is too short for automated Sanger sequencing that is required to confirm the molecular 80 diagnosis of B. miyamotoi [ 7, 12, 13]. In addition, the dye-labeled probe 6FAM-81 TTCGGTACTAACTTTTAGTTAA used for the real-time PCR screening [13] may miss the 82 species of B. valaisiana and B. lusitaniae whose corresponding complementary sequences in this 83 segment are TTAACTGAAAGTTAGTACCGAA (Sequence ID: NR_036807) and 84 TTAACTAACAGTTAGTACCGAA (Sequence ID: AB091822), respectively, not fully matched 85 with the sequence of the probe designed for other species of the B. burgdorferi sensu lato 86 complex. 87 In the current study, we used a pair of genus-specific PCR primers to amplify a highly conserved 88 segment with single-nucleotide polymorphisms of the borrelial 16S rRNA gene shared by all 89 known pathogenic borrelial strains to survey the borrelial infections among the I. ricinus ticks 90 collected in Ireland. Since this PCR amplicon is 357/358 bp long, the PCR products can be used 91 as the templa...