The Vpu accessory protein promotes HIV-1 release by counteracting Tetherin/BST-2, an interferon-regulated restriction factor, which retains virions at the cell-surface. Recent reports proposed β-TrCP-dependent proteasomal and/or endo-lysosomal degradation of Tetherin as potential mechanisms by which Vpu could down-regulate Tetherin cell-surface expression and antagonize this restriction. In all of these studies, Tetherin degradation did not, however, entirely account for Vpu anti-Tetherin activity. Here, we show that Vpu can promote HIV-1 release without detectably affecting Tetherin steady-state levels or turnover, suggesting that Tetherin degradation may not be necessary and/or sufficient for Vpu anti-Tetherin activity. Even though Vpu did not enhance Tetherin internalization from the plasma membrane (PM), it did significantly slow-down the overall transport of the protein towards the cell-surface. Accordingly, Vpu expression caused a specific removal of cell-surface Tetherin and a re-localization of the residual pool of Tetherin in a perinuclear compartment that co-stained with the TGN marker TGN46 and Vpu itself. This re-localization of Tetherin was also observed with a Vpu mutant unable to recruit β-TrCP, suggesting that this activity is taking place independently from β-TrCP-mediated trafficking and/or degradation processes. We also show that Vpu co-immunoprecipitates with Tetherin and that this interaction involves the transmembrane domains of the two proteins. Importantly, this association was found to be critical for reducing cell-surface Tetherin expression, re-localizing the restriction factor in the TGN and promoting HIV-1 release. Overall, our results suggest that association of Vpu to Tetherin affects the outward trafficking and/or recycling of the restriction factor from the TGN and as a result promotes its sequestration away from the PM where productive HIV-1 assembly takes place. This mechanism of antagonism that results in TGN trapping is likely to be augmented by β-TrCP-dependent degradation, underlining the need for complementary and perhaps synergistic strategies to effectively counteract the powerful restrictive effects of human Tetherin.

Human immunodeficiency virus type 1 (HIV-1) viral protein R (Vpr) has been shown to cause G2 cell cycle arrest in human cells by inducing ATR-mediated inactivation of p34cdc2, but factors directly engaged in this process remain unknown. We used tandem affinity purification to isolate native Vpr complexes. We found that damaged DNA binding protein 1 (DDB1), viral protein R binding protein (VPRBP), and cullin 4A (CUL4A)—components of a CUL4A E3 ubiquitin ligase complex, DDB1-CUL4AVPRBP —were able to associate with Vpr. Depletion of VPRBP by small interfering RNA impaired Vpr-mediated induction of G2 arrest. Importantly, VPRBP knockdown alone did not affect normal cell cycle progression or activation of ATR checkpoints, suggesting that the involvement of VPRBP in G2 arrest was specific to Vpr. Moreover, leucine/isoleucine-rich domain Vpr mutants impaired in their ability to interact with VPRBP and DDB1 also produced strongly attenuated G2 arrest. In contrast, G2 arrest–defective C-terminal Vpr mutants were found to maintain their ability to associate with these proteins, suggesting that the interaction of Vpr with the DDB1-VPRBP complex is necessary but not sufficient to block cell cycle progression. Overall, these results point toward a model in which Vpr could act as a connector between the DDB1-CUL4AVPRBP E3 ubiquitin ligase complex and an unknown cellular factor whose proteolysis or modulation of activity through ubiquitination would activate ATR-mediated checkpoint signaling and induce G2 arrest.

Human Staufen (hStau), a double-stranded RNA (dsRNA)-binding protein that is involved in mRNA transport, is incorporated in human immunodeficiency virus type 1 (HIV-1) and in other retroviruses, including HIV-2 and Moloney murine leukemia virus. Sucrose and Optiprep gradient analyses reveal cosedimentation of hStau with purified HIV-1, while subtilisin assays demonstrate that it is internalized. hStau incorporation in HIV-1 is selective, is dependent on an intact functional dsRNA-binding domain, and quantitatively correlates with levels of encapsidated HIV-1 genomic RNA. By coimmunoprecipitation and reverse transcription-PCR analyses, we demonstrate that hStau is associated with HIV-1 genomic RNA in HIV-1-expressing cells and purified virus. Overexpression of hStau enhances virion incorporation levels, and a corresponding, threefold increase in HIV-1 genomic RNA encapsidation levels. This coordinated increase in hStau and genomic RNA packaging had a significant negative effect on viral infectivity. This study is the first to describe hStau within HIV-1 particles and provides evidence that hStau binds HIV-1 genomic RNA, indicating that it may be implicated in retroviral genome selection and packaging into assembling virions.

No abstract

Background: HIV-1 Vpu targets newly synthesized CD4 receptor for rapid degradation by a process reminiscent of endoplasmic reticulum (ER)-associated protein degradation (ERAD). Vpu is thought to act as an adaptor protein, connecting CD4 to the ubiquitin (Ub)-proteasome degradative system through an interaction with β-TrCP, a component of the SCF β-TrCP E3 Ub ligase complex.

Gag proteins are necessary and sufficient to direct human immunodeficiency virus type 1 (HIV-1) particle assembly and budding. Recent evidence suggests that Gag targeting to late endosomal/multivesicular body (LE/MVB) compartments occurs prior to viral particle budding at the plasma membrane (PM). However, the route that Gag follows before reaching its steady-state destinations still remains a subject of debate. Using a subcellular fractionation method that separates PM from LE/MVB combined with pulse-chase labeling, we analyzed Gag trafficking in HIV-1-producing HEK 293T cells. Our results reveal that the majority of newly synthesized Gag is primarily targeted to the PM. While PM-targeted Gag was efficiently released, a significant fraction of the remaining cell surface-associated Gag was found to be subsequently internalized to LE/MVB, where it accumulated, thus accounting for the majority of LE/MVB-associated Gag. Importantly, this accumulation of Gag in LE/MVB was found to be cholesterol dependent since it was sensitive to the sterol-binding drugs filipin and methyl-␤-cyclodextrin. These results point towards the PM as being the primary site of productive HIV-1 assembly in cells that also support Gag accumulation in intracellular compartments.

Intracellular trafficking of retroviral RNAs is a potential mechanism to target viral gene expression to specific regions of infected cells. Here we show that the human immunodeficiency virus type 1 (HIV-1) genome contains two sequences similar to the hnRNP A2 response element (A2RE), a cis-acting RNA trafficking sequence that binds to the trans-acting trafficking factor, hnRNP A2, and mediates a specific RNA trafficking pathway characterized extensively in oligodendrocytes. The two HIV-1 sequences, designated A2RE-1, within the major homology region of the gag gene, and A2RE-2, in a region of overlap between the vpr and tat genes, both bind to hnRNP A2 in vitro and are necessary and sufficient for RNA transport in oligodendrocytes in vivo. A single base change (A8G) in either sequence reduces hnRNP A2 binding and, in the case of A2RE-2, inhibits RNA transport. A2RE-mediated RNA transport is microtubule and hnRNP A2 dependent. Differentially labelled gag and vpr RNAs, containing A2RE-1 and A2RE-2, respectively, coassemble into the same RNA trafficking granules and are cotransported to the periphery of the cell. tat RNA, although it contains A2RE-2, is not transported as efficiently as vpr RNA. An A2RE/hnRNP A2-mediated trafficking pathway for HIV RNA is proposed, and the role of RNA trafficking in targeting HIV gene expression is discussed.Many eucaryotic RNAs have characteristic intracellular trafficking pathways determined by cis-acting elements in the RNA and trans-acting factors in the cell. cis and trans trafficking determinants have been identified for actin mRNA in fibroblasts (38), Vg1 mRNA in frog oocytes (17) and myelin basic protein (MBP) mRNA in oligodendrocytes (11). In the case of MBP mRNA, a 21-nucleotide (nt) cis-acting sequence (GCCAAGGAGCCAGAGAGCATG) mediates RNA trafficking. This sequence, originally termed the RNA trafficking sequence (2), is now referred to as the hnRNP A2 response element (A2RE) because in binds to the trans-acting factor hnRNP A2 in vitro (21), because its RNA trafficking functions are hnRNP A2 dependent (23), and because A2RE mutations that interfere with hnRNP A2 binding abolish RNA trafficking (31).A2RE and/or hnRNP A2 determinants have been implicated at several different steps in RNA trafficking. In the nucleus, hnRNP A2 associates nonspecifically with newly synthesized RNA transcripts as part of the core hnRNP complex (18) and specifically regulates splice site selection in certain transcripts (29). In Drosophila melanogaster, an hnRNP A2 orthologue, Squid protein, associates with pair-rule transcripts in the nucleus and mediates their subsequent apical localization in the cytoplasm (24). In the silkmoth Chironomus, hnRNP A2 class proteins accompany Balbiani ring mRNA during export through the nuclear pore and into polyribosomes (14,15,43). In oligodendrocytes, hnRNP A2 mediates anterograde transport of A2RE-containing RNA granules (6) along microtubules (2, 11), and translation of A2RE-containing RNA is enhanced by hnRNP A2 in vivo and in vitro (23). Since A2RE-like...

Bone marrow stromal cell antigen-2 (BST-2) inhibits human immunodeficiency virus type 1 (HIV-1) release by cross-linking nascent virions on infected cell surface. HIV-1 Vpu is thought to antagonize BST-2 by downregulating its surface levels via a mechanism that involves intracellular sequestration and lysosomal degradation. Here, we investigated the functional importance of cell-surface BST-2 downregulation and the BST-2 pools targeted by Vpu using an inducible proviral expression system. Vpu established a surface BST-2 equilibrium at ∼60% of its initial levels within 6 h, a condition that coincided with detection of viral release. Analysis of BST-2 post-endocytic trafficking revealed that the protein is engaged in a late endosomal pathway independent of Vpu. While Vpu moderately enhanced cell-surface BST-2 clearance, it strongly affected the protein resupply to the plasma membrane via newly synthesized proteins. Noticeably, Vpu affected clearance of surface BST-2 more substantially in Jurkat T cells than in HeLa cells, suggesting a cell-dependent impact of Vpu on the pool of surface BST-2. Collectively, our data reveal that Vpu imposes a new BST-2 equilibrium, incompatible with efficient restriction of HIV-1 release, by combining an acceleration of surface BST-2 natural clearance, whose degree might be cell-type dependent, to a severe impairment of the protein resupply to the plasma membrane.