Platinum based anticancer agents are widely applied in clinic and their major target is believed to be DNA. Herein, the interaction of a photoactivatable diazido Pt(IV) anticancer prodrug trans,trans,trans-[Pt(N3)2(OH)2(py)2] (py...

The interaction of the organometallic ruthenium(II) anticancer complex [(η 6 -biphenyl)Ru(en)Cl][PF 6 ] (1; en = ethylenediamine) and a 22-mer human telomeric G-quadruplex (G4) DNA (sequence 5′-A 1 GGGTTAGGGTTAGGGTTAGGG 22 -3′; I) was investigated by mass spectrometry analysis. Electrospray ionization mass spectrometry (ESI-MS) was first applied to probe the interaction of complex 1 with an equal molar ratio of human telomeric G-quadruplex DNA I (G4-I) under negative-ion mode. Tandem mass spectrometry using collision-induced dissociation (CID) was further introduced to identify the ruthenation sites. Primary mass spectrometric results showed that monoruthenated and diruthenated G4-I adducts were the main products under the given conditions. MS/MS results by the CID fragmentation of monoruthenated G4-I indicated that ruthenium complex 1 binds at T 17 or T 6 on G4-I. Further fragmentation of diruthenated G4-I confirmed preferential ruthenation at both T 17 and T 6 , while no ruthenation at the guanine base was observed. This is the first report to identify the binding sites of organometallic ruthenium(II) anticancer complexes to human telomeric G-quadruplex DNA using tandem MS. Given the preferential binding of complex 1 at guanine bases of ssDNA and dsDNA, the preferential ruthenation of thymine over guanine in the G-rich human telomeric DNA implicates that thymines located in the flexible loops are more likely to be involved in interactions of the organometallic ruthenium anticancer complex with telomeric DNA when the guanine bases are engaged in the G-quartets of the G-quadruplex DNA.

CpG and its cytosine-methylated counterpart (5mCpG) are unique reversible pair of sequences in regulating the expression of genes epigenetically. As DNA is the potential target of Pt-based anticancer metallodrugs, herein,...

IntroductionIn the field of upper limb brain computer interfaces (BCIs), the research focusing on bilateral decoding mostly based on the neural signals from two cerebral hemispheres. In addition, most studies used spikes for decoding. Here we examined the representation and decoding of different laterality and regions arm motor imagery in unilateral motor cortex based on local field potentials (LFPs).MethodsThe LFP signals were recorded from a 96-channel Utah microelectrode array implanted in the left primary motor cortex of a paralyzed participant. There were 7 kinds of tasks: rest, left, right and bilateral elbow and wrist flexion. We performed time-frequency analysis on the LFP signals and analyzed the representation and decoding of different tasks using the power and energy of different frequency bands.ResultsThe frequency range of <8 Hz and >38 Hz showed power enhancement, whereas 8–38 Hz showed power suppression in spectrograms while performing motor imagery. There were significant differences in average energy between tasks. What’s more, the movement region and laterality were represented in two dimensions by demixed principal component analysis. The 135–300 Hz band signal had the highest decoding accuracy among all frequency bands and the contralateral and bilateral signals had more similar single-channel power activation patterns and larger signal correlation than contralateral and ipsilateral signals, bilateral and ipsilateral signals.DiscussionThe results showed that unilateral LFP signals had different representations for bilateral motor imagery on the average energy of the full array and single-channel power levels, and different tasks could be decoded. These proved the feasibility of multilateral BCI based on the unilateral LFP signal to broaden the application of BCI technology.Clinical trial registrationhttps://www.chictr.org.cn/showproj.aspx?proj=130829, identifier ChiCTR2100050705.

IntroductionHow the human brain coordinates bimanual movements is not well-established.MethodsHere, we recorded neural signals from a paralyzed individual’s left motor cortex during both unimanual and bimanual motor imagery tasks and quantified the representational interaction between arms by analyzing the tuning parameters of each neuron.ResultsWe found a similar proportion of neurons preferring each arm during unimanual movements, however, when switching to bimanual movements, the proportion of contralateral preference increased to 71.8%, indicating contralateral lateralization. We also observed a decorrelation process for each arm’s representation across the unimanual and bimanual tasks. We further confined that these changes in bilateral relationships are mainly caused by the alteration of tuning parameters, such as the increased bilateral preferred direction (PD) shifts and the significant suppression in bilateral modulation depths (MDs), especially the ipsilateral side.DiscussionThese results contribute to the knowledge of bimanual coordination and thus the design of cutting-edge bimanual brain-computer interfaces.