Abstract. Various features of the biology of the rust fungi and of the epidemiology of the plant diseases they cause illustrate the important role of rainfall in their life history. Based on this insight we have characterized the ice nucleation activity (INA) of the aerially disseminated spores (urediospores) of this group of fungi. Urediospores of this obligate plant parasite were collected from natural infections of 7 species of weeds in France, from coffee in Brazil and from field and greenhouse-grown wheat in France, the USA, Turkey and Syria. Immersion freezing was used to determine freezing onset temperatures and the abundance of ice nuclei in suspensions of washed spores. Microbiological analyses of spores from France, the USA and Brazil, and subsequent tests of the ice nucleation activity of the bacteria associated with spores were deployed to quantify the contribution of bacteria to the ice nucleation activity of the spores. All samples of spores were ice nucleation active, having freezing onset temperatures as high as −4 °C. Spores in most of the samples carried cells of ice nucleation-active strains of the bacterium Pseudomonas syringae (at rates of less than 1 bacterial cell per 100 urediospores), but bacterial INA accounted for only a small fraction of the INA observed in spore suspensions. Changes in the INA of spore suspensions after treatment with lysozyme suggest that the INA of urediospores involves a polysaccharide. Based on data from the literature, we have estimated the concentrations of urediospores in air at cloud height and in rainfall. These quantities are very similar to those reported for other biological ice nucleators in these same substrates. However, at cloud level convective activity leads to widely varying concentrations of particles of surface origin, so that mean concentrations can underestimate their possible effects on clouds. We propose that spatial and temporal concentrations of biological ice nucleators active at temperatures > −10 °C and the specific conditions under which they can influence cloud glaciation need to be further evaluated so as to understand how evolutionary processes could have positively selected for INA.

Plant endophytes are a group of microorganisms that reside asymptomatically within the healthy living tissue. The diversity and molecular and biochemical characterization of industrial hemp-associated endophytes have not been previously studied. This study explored the abundance and diversity of culturable endophytes residing in petioles, leaves, and seeds of three industrial hemp cultivars, and examined their biochemical attributes and antifungal potential. A total of 134 bacterial and 53 fungal strains were isolated from cultivars Anka, CRS-1, and Yvonne. The number of bacterial isolates was similarly distributed among the cultivars, with the majority recovered from petiole tissue. Most fungal strains originated from leaf tissue of cultivar Anka. Molecular and phylogenetic analyses grouped the endophytes into 18 bacterial and 13 fungal taxa, respectively. The most abundant bacterial genera were Pseudomonas, Pantoea, and Bacillus, and the fungal genera were Aureobasidium, Alternaria, and Cochliobolus. The presence of siderophores, cellulase production, and phosphorus solubilization were the main biochemical traits. In proof-of-concept experiments, re-inoculation of tomato roots with some endophytes confirmed their migration to aerial tissues of the plant. Taken together, this study demonstrates that industrial hemp harbours a diversity of microbial endophytes, some of which could be used in growth promotion and (or) in biological control designed experiments.

Biotic stress, as a result of plant-pathogen interactions, induces the accumulation of reactive oxygen species in the cells, causing severe oxidative damage to plants and pathogens. To overcome this damage, both the host and pathogen have developed antioxidant systems to quench excess ROS and keep ROS production and scavenging systems under control. Data on ROS-scavenging systems in the necrotrophic plant pathogen Rhizoctonia solani are just emerging. We formerly identified vitamin B6 biosynthetic machinery of R. solani AG3 as a powerful antioxidant exhibiting a high ability to quench ROS, similar to CATALASE (CAT) and GLUTATHIONE S-TRANSFERASE (GST). Here, we provide evidence on the involvement of R. solani vitamin B6 biosynthetic pathway genes; RsolPDX1 (KF620111.1), RsolPDX2 (KF620112.1), and RsolPLR (KJ395592.1) in vitamin B6 de novo biosynthesis by yeast complementation assays. Since gene expression studies focusing on oxidative stress responses of both the plant and the pathogen following R. solani infection are very limited, this study is the first coexpression analysis of genes encoding vitamin B6, CAT and GST in plant and fungal tissues of three pathosystems during interaction of different AG groups of R. solani with their respective hosts. The findings indicate that distinct expression patterns of fungal and host antioxidant genes were correlated in necrotic tissues and their surrounding areas in each of the three R. solani pathosystems: potato sprout-R. solani AG3; soybean hypocotyl-R. solani AG4 and soybean leaves-R. solani AG1-IA interactions. Levels of ROS increased in all types of potato and soybean tissues, and in fungal hyphae following infection of R. solani AGs as determined by non-fluorescence and fluorescence methods using H2DCF-DA and DAB, respectively. Overall, we demonstrate that the co-expression and accumulation of certain plant and pathogen ROS-antioxidant related genes in each pathosystem are highlighted and might be critical during disease development from the plant’s point of view, and in pathogenicity and developing of infection structures from the fungal point of view.

Vitamin B6 is recognized as an important cofactor required for numerous metabolic enzymes, and has been shown to act as an antioxidant and play a role in stress responses. It can be synthesized through two different routes: salvage and de novo pathways. However, little is known about the possible function of the vitamin B6 pathways in the fungal plant pathogen Rhizoctonia solani. Using genome walking, the de novo biosynthetic pathway genes; RsolPDX1 and RsolPDX2 and the salvage biosynthetic pathway gene, RsolPLR were sequenced. The predicted amino acid sequences of the three genes had high degrees of similarity to other fungal PDX1, PDX2, and PLR proteins and are closely related to other R. solani anastomosis groups. We also examined their regulation when subjected to reactive oxygen species (ROS) stress inducers, the superoxide generator paraquat, or H2O2, and compared it to the well-known antioxidant genes, catalase and glutathione-S-transferase (GST). The genes were differentially regulated with transcript levels as high as 33 fold depending on the gene and type of stress reflecting differences in the type of damage induced by ROS. Exogenous addition of the vitamers PN or PLP in culture medium significantly induced the transcription of the vitamin B6 de novo encoding genes as early as 0.5 hour post treatment (HPT). On the other hand, transcription of RsolPLR was vitamer-specific; a down regulation upon supplementation of PN and upregulation with PLP. Our results suggest that accumulation of ROS in R. solani mycelia is linked to transcriptional regulation of the three genes and implicate the vitamin B6 biosynthesis machinery in R. solani, similar to catalases and GST, as an antioxidant stress protector against oxidative stress.

During the second squash cropping season, which coincides with high whitefly populations, a high incidence of plants with severe leaf curl symptoms was observed. Many farmers reported yield losses ranging from 70 to 80%. Surveys were conducted over five cropping seasons (2008 to 2010) and covered the coastal areas of Lebanon. A total of 675 samples were collected, including cucumber (Cucumis sativus), squash (Cucurbita sp.), melon (Cucumis melo), and watermelon (Citrullus lanatus). All squash samples had leaf curl symptoms, whereas 75 to 85% of cucumber, melon, and watermelon samples showed yellowing symptoms. The remaining 15 to 25% were asymptomatic. Total nucleic acids were extracted according to a small-scale CTAB protocol (4). PCR assays were initially conducted using the universal degenerate primers PAL1v1978 and PAR1c496, designed to detect DNA-A of several begomoviruses (3). Following sequencing of 22 randomly selected amplicons, BLASTN analysis showed that 19 samples were infected with Squash leaf curl virus (SLCV). SLCV specific primers: (SqA1R: 5′AGCTGTATCTTGGGCAACAGA3′ and SqA2F: 5′TATCTCCCATCTTGGCAAGG3′; amplicon size: 601 bp) were used for detection in the 675 samples. SLCV was detected in 223/249 (89%), 83/145 (57%), 129/229 (56%), and 25/52 (48%) of squash, cucumber, melon, and watermelon samples, respectively. The SLCV genome from a symptomatic squash plant collected from Akkar, North Lebanon, was amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare). The product was used for biolistic inoculation of squash and cucumber as described (2). Severe leaf curl symptoms were observed on 7/10 of the squash seedlings (cv. Camelia F1) within 2 weeks of inoculation. However, no symptoms were observed on cucumber (cv. Beit alpha) 1 month after inoculation, even though 6/11 (54%) of the plants were positive for SLCV in PCR assays. Several primer sets were used for sequencing the full SLCV genome using the RCA product as template. The sequences were submitted to GenBank under accession numbers HM368373 and HM368374 (SLCV DNA A and B, respectively). Phylogenetic analysis showed that SLCV DNA A was most closely related to SLCV isolates from Egypt (DQ285019) and Israel (HQ184436) with 99% nucleotide identity; SLCV DNA B was most closely related to the same SLCV isolate from Israel (HQ184437) with 99% nucleotide identity. SLCV was first observed on squash in California in 1977, but was introduced during the last decade to the Mediterranean region (1) and currently is widespread all over Lebanon, posing a great threat to squash production. References: (1) Antignus et al. Phytoparasitica 31:415, 2003. (2) Guenoune-Gelbart et al. J. Virol. Methods 168:87, 2010. (3) Rojas et al. Plant Dis. 77:340, 1993. (4) Zhang et al. J. Virol. Methods 71:45, 1998.

Rhizoctonia solani is a plant pathogenic fungus that causes black scurf on tubers and stem and stolon canker on underground parts of potato plant. Early in the season, the fungus attacks germinating sprouts underground before they emerge from the soil. Damage at this stage results in delayed emergence of weakened plants with poor and uneven stands. The mechanism underlying this phenomenon has been investigated in this study by coupling a cDNA-suppression subtractive hybridization (SSH) library to differential screening to identify transcripts of R. solani that are down-regulated during infection of potato sprouts. We report on the identification of 33 unique genes with functions related to carbohydrate binding, vitamin synthesis, pathogenicity, translation, ATP and nucleic acid binding and other categories. RACE-PCR was used to clone and characterize the first full-length cDNA clones, RSENDO1 and RSGLYC1 that encode for an eukaryotic delta-endotoxin CytB protein and an intracellular glycosyl hydrolase, respectively. Quantitative real-time PCR revealed the down-regulation of RSENDO1 during infection of potato sprouts and the up-regulation of RSGLYC1 when the fungus was grown on a cellulose-based nutrient medium. In contrast, additional experiments have highlighted the down-regulation of RSENDO1 when R. solani was co-cultured with the mycoparasite Stachybotrys elegans and the bacterial antagonist Bacillus subtilis B26. These results advance our understanding of R. solani-potato interaction in subterranean parts of the plant. Such approaches could be considered in building an efficient integrated potato disease management program.

Literature confirms that using polyethylene glycol (PEG) as an osmotic agent to imitate water shortage was not so easy in practice, due to PEG toxicity effects and frequent contaminations. Two new approaches were developed to alleviate those problems, one using a raft covered with a membrane to prevent PEG entry in roots, and one using solidified PEG media. The raft trials were done on corn, hexaploid and tetraploid wheat, rye, triticale, oats, barley, Agrotricum; those in solid media, with corn, hexaploid and tetraploid wheat, barley, sorghum and pearl millet. Different species respond differently to PEG-induced osmotic stress. In our trials, the most sensitive cereal was corn, and this finding correlates with the lower osmotic pressure of the sap (a constitutive trait in corn seedlings). Corn responded to osmotic stress by a very poor rate of elongation of the coleoptile, especially when the highest stress (32% PEG) was used. This behavior was also observed in the field in dry years, for example in the Sahel area. Compared to this sensitive cereal species, all other cereals tested were more resistant. Hexaploid and tetraploid wheat, triticale, and Agrotricum kept capacity to elongate roots when submitted to a high osmotic stress, but the higher stress reduced root length considerably. Barley kept rooting ability like other cereals, but was able to develop more aerial biomass, seminal roots, and ramifications. Barley root hair was also longer and covered a higher proportion of the root. Those adaptive features likely explain part of the good adaptation of barley to dry Mediterranean areas. Preliminary results on solid media also showed relationships between drought resistance and the osmoresistance response, at least when comparing species. Roots of species adapted to hot climate, like pearl millet and sorghum, had few seminal roots but displayed a strong gravitropism under osmotic stress. The ease of use of solidified PEG media shows promise for future larger scale trials. Applications of solidified PEG media for research beyond cereal crops is envisioned.

Vitamin B6 is well recognized as an essential antioxidant and plays a role in stress responses. Co-expression of plant and pathogen-derived vitamin B6 genes is critical during disease development of R. solani. However, little is known about the functionality of vitamin B6 vitamers during plant-R. solani interactions and their involvement in disease tolerance. Here, we explored the possible involvement of vitamin B6 during disease progression of potato cultivars of different susceptibility levels to R. solani. A distinct pattern of gene expression, pyridoxine (PN) concentration, and fungal biomass was found in the susceptible cv. Russet Burbank and tolerant cv. Chieftain. Accumulation of reactive oxygen species (ROS) in R. solani mycelia or plant tissues applying non-fluorescence or fluorescence methods was related to up-regulation in the vitamin B6 pathway and is indicative of oxidative stress. Russet Burbank was susceptible to R. solani, which was linked to reduced amounts of VB6 content. Prior to infection, constitutive PN levels were significantly higher in Russet Burbank by 1.6-fold compared to Chieftain. Upon infection with R. solani, PN levels in infected tissues increased more in Chieftain (1.7-fold) compared to Russet Burbank (1.4fold). R. solani AG3 infection of potato sprouts in both cultivars significantly activates the fungal and plant vitamin B6 and glutathione-S-transferase (GST) genes in a tissuespecific response. Significant fold increases of transcript abundance of the fungal genes ranged from a minimum of 3.60 (RsolSG3GST) to a maximum of 13.91 (RsolAG3PDX2) in the surrounding necrotic lesion tissues (zone 1). On the other hand, PCA showed that the top plant genes STGST and STPDX1.1 were linked to both tissues of necrotic lesions (zone 2) and their surrounding areas of necrotic lesions. Functional characterization of Arabidopsis pdx1.3 mutants challenged with R. solani provided evidence into the role of the vitamin B6 pathway in the maintenance of plant tolerance during disease progression. Overall, we demonstrate that the production of vitamin VB6 is under tight control and is an essential determinant of disease development during the interaction of R. solani with potato cultivars.