Low body mass index (BMI) is a well-documented risk factor for future fracture. The aim of this study was to quantify this effect and to explore the association of BMI with fracture risk in relation to age, gender and bone mineral density (BMD) from an international perspective using worldwide data. We studied individual participant data from almost 60,000 men and women from 12 prospective population-based cohorts comprising Rotterdam, EVOS/EPOS, CaMos, Rochester, Sheffield, Dubbo, EPIDOS, OFELY, Kuopio, Hiroshima, and two cohorts from Gothenburg, with a total follow-up of over 250,000 person years. The effects of BMI, BMD, age and gender on the risk of any fracture, any osteoporotic fracture, and hip fracture alone was examined using a Poisson regression model in each cohort separately. The results of the different studies were then merged. Without information on BMD, the age-adjusted risk for any type of fracture increased significantly with lower BMI. Overall, the risk ratio (RR) per unit higher BMI was 0.98 (95% confidence interval [CI], 0.97-0.99) for any fracture, 0.97 (95% CI, 0.96-0.98) for osteoporotic fracture and 0.93 (95% CI, 0.91-0.94) for hip fracture (all p <0.001). The RR per unit change in BMI was very similar in men and women ( p >0.30). After adjusting for BMD, these RR became 1 for any fracture or osteoporotic fracture and 0.98 for hip fracture (significant in women). The gradient of fracture risk without adjustment for BMD was not linearly distributed across values for BMI. Instead, the contribution to fracture risk was much more marked at low values of BMI than at values above the median. This nonlinear relation of risk with BMI was most evident for hip fracture risk. When compared with a BMI of 25 kg/m(2), a BMI of 20 kg/m(2) was associated with a nearly twofold increase in risk ratio (RR=1.95; 95% CI, 1.71-2.22) for hip fracture. In contrast, a BMI of 30 kg/m(2), when compared with a BMI of 25 kg/m(2), was associated with only a 17% reduction in hip fracture risk (RR=0.83; 95% CI, 0.69-0.99). We conclude that low BMI confers a risk of substantial importance for all fractures that is largely independent of age and sex, but dependent on BMD. The significance of BMI as a risk factor varies according to the level of BMI. Its validation on an international basis permits the use of this risk factor in case-finding strategies.
The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.