With a stepwise degradation and terminal labeling procedure the 3'-terminal sequence of E. coli 16S ribosomal RNA is shown to be Pyd-A-C-C-U-C-C-U-U-A(OH). It is suggested that this region of the RNA is able to interact with mRNA and that the 3'-terminal U-U-A(OH) is involved in the termination of protein synthesis through base-pairing with terminator codons. The sequence A-C-C-U-C-C could recognize a conserved sequence found in the ribosome binding sites of various coliphage mRNAs; it may thus be involved in the formation of the mRNA.30S subunit complex.

The sequence of the 3'-terminus of 16S RNA from different bacteria has been determined. Complementarity relationships between this sequence and a purine-rich tract in the ribosome binding site of different bacterial mRNAs suggest that the 3'-end of 16S RNA determines the intrinsic capacity of ribosomes to translate a particular cistron.

The mechanism by which the estrogen receptor and other steroid hormone receptors regulate gene expression in eukaryotic cells is not well understood. In this study, a complementary DNA clone containing the entire translated portion of the messenger RNA for the estrogen receptor from MCF-7 human breast cancer cells was sequenced and then expressed in Chinese hamster ovary (CHO-K1) cells to give a functional protein. An open reading frame of 1785 nucleotides in the complementary DNA corresponded to a polypeptide of 595 amino acids and a molecular weight of 66,200, which is in good agreement with published molecular weight values of 65,000 to 70,000 for the estrogen receptor. Homogenates of transformed Chinese hamster ovary cells containing a protein that bound [3H]estradiol and sedimented as a 4S complex in salt-containing sucrose gradients and as an 8 to 9S complex in the absence of salt. Interaction of this receptor-[3H]estradiol complex with a monoclonal antibody that is specific for primate ER confirms the identity of the expressed complementary DNA as human estrogen receptor. Amino acid sequence comparisons revealed significant regional homology among the human estrogen receptor, the human glucocorticoid receptor, and the putative v-erbA oncogene product. This suggests that steroid receptor genes and the avian erythroblastosis viral oncogene are derived from a common primordial gene. The homologous region, which is rich in cysteine, lysine, and arginine, may represent the DNA-binding domain of these proteins.

Recombinant bacterial plasmids have been constructed that contain complementary DNA prepared from rat islets of Langerhans messenger RNA. Three plasmids contain cloned sequences representing the complete coding region of rat proinsulin I, part of the preproinsulin I prepeptide, and the untranslated 3' terminal region of the mRNA. A fourth plasmid contains sequences derived from the A chain region of rat preproinsulin II.

containing 1 x 106 cpm of nick-translated probe per ml (12). After being washed three times at 60'C in 0.5 x SSC to remove excess probe, the filters were exposed to X-ray film (Kodak X-Omat S) at -700C with an intensifying screen. Hybridization-positive phage were isolated, and their inserts were subcloned into the EcoRI site of M13mp8. AVDR1 was obtained in this fashion and subsequently used to screen an Okayama-Berg (13) T47D cDNA library (provided by G. Ringold, Stanford University), yielding clone VDR3, and a specifically primed AgtlO T47D library yielding clone AVDR2. The latter was made by substituting the oligonucleotide 5' ACACACCCCACAGATCCGGGG 3' for oligo(dT) in the first strand reaction (underlined in Fig. 2).DNA Sequence Analysis. Three overlapping clones were used to generate the full-length VDR sequence cDNA inserts to be sequenced. These clones were subcloned into the EcoRI site of M13mp8 for sequencing by the dideoxynucleotide chain-termination method (14). Primers were either the M13 universal primer or sequence-derived oligonucleotides.RNA Blot Hybridization. Total RNA was isolated from each of three cell lines (15), and the mRNA fraction was selected by successive passages over oligo(dT)-cellulose (16). The mRNA samples (10 ,ug) were resolved on a 1% formaldehyde-agarose gel (17) and then transferred electrophoretically to a nylon membrane (Nytran; Schleicher & Schuell). The filter was hybridized to nick-translated hVDR-1(1 x 108 cpm/,ug; 1 x 106 cpm/ml) using the conditions described above.Expression