Blended learning is becoming an attractive model in higher Education as new innovative information technologies are becoming increasingly available. However, just blending face-toface learning with information technologies cannot provide effective teaching and efficient solutions for learning. To succeed, blended learning must rely on solid learning theory, pedagogical strategies, course design methods, especially lectures, scenario builders, and course implementers. The paper presents research findings on specific course designs in which researcher and lecturer work closely with each other. The Blended learning course was designed, implemented, and redesigned to make the Blended learning course an effective and efficient learning environment. This study proposed what elements were needed to successfully assist a higher education lecturer in designing and teaching a Blended learning course.
Waxy genes of the original variety and its mutant type were sequenced by Sanger method and compared through Nucleotide Basic Local Alignment Search Tool (BLASTN) to clarify differences. BLASTN result showed four nucleotide mutations in coding regions and 59 nucleotide mutations in noncoding regions. Four point mutations in coding regions were: the deletion of T/- at position 34 and the insertion of -/T between positions 70 and 71 in exon 3; the substitution of C/T at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9. In 59 mutant nucleotides in non-coding regions, somesignificant alterations were list: the deletion of nucleotide G at the first of intron 6 and the addition of 32 nucleotides “GGGCCTGCGAAGAACTGGGAGAATGTGCTCCT” at the end of intron 12. For the first trial, a new DNA marker was developed based on the mutation C/T at at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9 to improve efficiency of rice breeding relevant to Waxy gene.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.