Jerusalem artichoke is a tuber-producing plant in the Asteraceae that has been widely planted throughout the Qinghai Plateau as a erosion control measure, due to its sand-binding root system. Jerusalem artichoke has been widely planted throughout the Qinghai Plateau, due to its excellent stress resistance and wind and sand fixation characteristics. Jerusalem artichoke tubers can safely survive through the winter in the environment of -25ºC on the plateau, and its root system possesses a strong sand fixation ability. In recent years, the Jerusalem artichoke has been used for desertification control in the area surrounding Qinghai Lake and Tengri. However, during the winter its tubers stored in winter are susceptible to bacterial fungal infection, resulting in soft rot symptoms. It has been reported that during During thecold storage of harvested Jerusalem artichoke tubers the fungus Rhizopus stolonifer may cause disease (Ghoneem et al., 2016; Kays and Nottingham, 2007; Kosaric et al., 1984). At the experimental site belonging to the Academy of Agricultural and Forestry Sciences of Qinghai University (N 36°43', E 101°44', 2265 m elevation) tubers stored during the period from 2016 to 2018 suffered annual losses to storage decay of 30--50%. From 2016 to 2018, the loss of annual storage decay rate of Jerusalem artichoke planted at the experimental site belonging to the Academy of Agricultural and Forestry Sciences of Qinghai University was 30-50% (N 36°43′, E 101°44′, 2265 m elevation). During storage, the initial symptom was of white mycelium on the affected tubers. During storage, first white mycelium was observed on the tuber, after which a large-scale outbreak occurred. The fructan in the tuber had decomposed and fermented continuously, and as a result the tuber gradually rotted and softened. The moldy tubers were sterilized in 1％NaOCl and 70% ethanol for 2 min and 70% ethanol , for 15 s, then washed with sterile distilled water 4 four times. To isolate the pathogen, symptomatic tubers were Next, they were cut into about ca 1 1-cm pieces from the treated tuber epidermis of Jerusalem artichoke, inoculated onto potato dextrose agar (PDA), and placed at 25℃ for 7 d. When fungal colonies had grown out of the pieces of diseased tissue into the culture medium, a sterile cork borer was used to take plugs from the margins of selected colonies. Plugs from each colony were transferred to PDA plates and incubated. After 3-5 rounds of subculturing, a total of 10 fungal isolates had been successfully recovered from tuber tissue. These were determined to be morphologically identical to each other.When the colony had grown on the culture medium, a sterile perforator was used to pick out the fungus blocks surrounding each the single colony with different characteristics, then these were inoculated to a new PDA plate for cultivation. After 3--5 rounds of subculturing, the colony was separated and purified, and a total of 10 bacterialten colonies strains were separated. It was found that Tthe macroscopic colony and microscopic morphology were the same in terms of morphology. The colony was initially circular with distinct margins, and the mycelium was cottonly with hyaline stolons present. With age, mycelium turned gray and black sporangia on long sporangiophores were found scattered throughout the colony. Colonies grew rapidly, filling the 40 mm-diameter culture dish in 2 d. The colony was initially round in shape with neat edges, and the mycelium was long and thin white fluff; the stolon was transparent and developed, and the mycelium changed to gray white at the later stage; black spores were scattered throughout the gray white fluff, and the colony grew very rapidly, filling the entire culture dish in about 2 d (r=40 mm). Microscopical observation showed that the sporangiophores were slightly curved, fascicular, each with an apical sporangium. Sporangia were spherical or nearly spherical, yellowish-white when immature, then turning black at maturity, when they measured 158.4 (132.1-225.3) µm (n=50). sporophore was slightly curved, mostly fascicular in shape, with a sporangium at the top. The sporangium was spherical or nearly spherical, with a size of 158.4 (132.1-225.3) μm (n=50). The sporangium was yellow white at birth, then turned black at maturity. The sporangiospore produced in the sporangium was 5.956.0 (3.22-8.253) × 5.12 (3.64-6.90) μm (n=50). The internal transcribed spacer (Jung et al., 2012) was amplified by ITS1/ITS4(CTTGGTCATTTAGAGGAAGTAA/TCCTCCGCTTATTGATATGC). The sequence obtained by ITS sequencing was uploaded to the NCBI gene database using the login ID MN242807. BLASTn analysis showed that the similarity between the sequence and that of Rhizopus arrhizusoryzae exceeded 99%. Next, to confirm to Koch's Postulates, healthy tubers of Jerusalem artichoke were inoculated with one of the isolates recovered from diseased tissue.Next, according to Koch's Rule, the healthy tubers of Jerusalem artichoke were reconnected and verified. A 1.0 mL volume sterile syringe was used to inject 50 uL of a 106 conidia/mL suspension into each of five healthy tubers, while five other tubers were injected with sterile water as the control. This pathogenicity test was repeated 3 times.After penetrating five tubers with a 1 mL sterile syringe, 50 uL 106 conidia/mL bacterial suspension was injected, while the other five tubers were injected with sterile water as the control. These were cultured in a constant temperature incubator at 18℃ for 7 d. The results of the pathogenicity test indicate that the separated Rhizopus oryzae Rhizopus arrhizus showed symptoms of water leaching on the tuber of the Jerusalem artichoke 3 d later, while black grey mould was found rapidly spreading throughout the tuber at about 7 d. Results of the three trials was the same: the pathogen-inoculated tubers began to show symptoms of water-soaking within three days, and greyish-black mycelium was visible around seven days. This showed that the fungus isolated from diseased tissue still exhibited strong pathogenicity upon re-inoculation and that symptoms from artificial inoculation resembled the original symptoms. The pathogen was re-isolated from the inoculated tubers and was confirmed to be Rhizopus arrhizus through ITS sequencing.The pathogenic bacteria resulting from the separation still exhibited strong pathogenicity. The symptoms of artificial pricking on the tuber were consistent with those of natural disease. Then, the pathogen was isolated from the Jerusalem artichoke tubers after inoculation and incidence, and it was confirmed as Rhizopus oryzae through ITS sequencing after separation. The returning inoculation pathogenicity experiment was repeated 3 times, and the results were the same. It has been reported that Rhizopus oryzae Rhizopus arrhizus infects root tuber cassava tubers and tuber potato tubers (Amadioha and Markson, 2007; Cui et al., 2019). To our knowledge, this is the first report time of Rhizopus oryzae Rhizopus arrhizusrelated causingto storage root soft rot of Jerusalem artichoke in China.

Jerusalem artichoke (JA) is a fructan-accumulating crop that has gained *CORRESPONDENCE