Telomeric ends of chromosomes, which comprise noncoding repeat sequences of guanine-rich DNA, are fundamental in protecting the cell from recombination and degradation. Disruption of telomere maintenance leads to eventual cell death, which can be exploited for therapeutic intervention in cancer. Telomeric DNA sequences can form four-stranded (quadruplex) structures, which may be involved in the structure of telomere ends. Here we describe the crystal structure of a quadruplex formed from four consecutive human telomeric DNA repeats and grown at a K(+) concentration that approximates its intracellular concentration. K(+) ions are observed in the structure. The folding and appearance of the DNA in this intramolecular quadruplex is fundamentally different from the published Na(+)-containing quadruplex structures. All four DNA strands are parallel, with the three linking trinucleotide loops positioned on the exterior of the quadruplex core, in a propeller-like arrangement. The adenine in each TTA linking trinucleotide loop is swung back so that it intercalates between the two thymines. This DNA structure suggests a straightforward path for telomere folding and unfolding, as well as ways in which it can recognize telomere-associated proteins.

G-quadruplexes are higher-order DNA and RNA structures formed from G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential quadruplex sequences have been identified in G-rich eukaryotic telomeres, and more recently in non-telomeric genomic DNA, e.g. in nuclease-hypersensitive promoter regions. The natural role and biological validation of these structures is starting to be explored, and there is particular interest in them as targets for therapeutic intervention. This survey focuses on the folding and structural features on quadruplexes formed from telomeric and non-telomeric DNA sequences, and examines fundamental aspects of topology and the emerging relationships with sequence. Emphasis is placed on information from the high-resolution methods of X-ray crystallography and NMR, and their scope and current limitations are discussed. Such information, together with biological insights, will be important for the discovery of drugs targeting quadruplexes from particular genes.

Maintenance of telomeres--specialized complexes that protect the ends of chromosomes--is undertaken by the enzyme complex telomerase, which is a key factor that is activated in more than 80% of cancer cells that have been examined so far, but is absent in most normal cells. So, targeting telomere-maintenance mechanisms could potentially half tumour growth across a broad spectrum of tumour types, with little cytotoxic effect outside tumours. Here, we describe the current understanding of telomere biology, and the application of this knowledge to the development of anticancer drugs.

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.

No abstract

The intriguing structural diversity in folded topologies available to guanine-rich nucleic acid repeat sequences have made four-stranded G-quadruplex structures the focus of both basic and applied research, from cancer biology and novel therapeutics through to nanoelectronics. Distributed widely in the human genome as targets for regulating gene expression and chromosomal maintenance, they offer unique avenues for future cancer drug development. In particular, the recent advances in chemical and structural biology have enabled the construction of bespoke selective DNA based aptamers to be used as novel therapeutic agents and access to detailed structural models for structure based drug discovery. In this critical review, we will explore the important underlying characteristics of G-quadruplexes that make them functional, stable, and predictable nanoscaffolds. We will review the current structural database of folding topologies, molecular interfaces and novel interaction surfaces, with a consideration to their future exploitation in drug discovery, molecular biology, supermolecular assembly and aptamer design. In recent years the number of potential applications for G-quadruplex motifs has rapidly grown, so in this review we aim to explore the many future challenges and highlight where possible successes may lie. We will highlight the similarities and differences between DNA and RNA folded G-quadruplexes in terms of stability, distribution, and exploitability as small molecule targets. Finally, we will provide a detailed review of basic G-quadruplex geometry, experimental tools used, and a critical evaluation of the application of high-resolution structural biology and its ability to provide meaningful and valid models for future applications (255 references).

No abstract

The crystal structure of a complex between the bimolecular human telomeric quadruplex d(TAGGGTTAGGGT)2 and the experimental anticancer drug BRACO-19, has been determined, to 2.5 A resolution. The binding site for the BRACO-19 molecule is at the interface of two parallel-folded quadruplexes, sandwiched between a G-tetrad surface and a TATA tetrad, and held in the site by networks of water molecules. The structure rationalizes the existing structure-activity data and provides a starting-point for the structure-based design of quadruplex-binding ligands