A significant proportion of disease-causing mutations affect precursor-mRNA splicing, inducing skipping of the exon from the mature transcript. Using F9 exon 5, CFTR exon 12 and SMN2 exon 7 models, we characterized natural mutations associated to exon skipping in Haemophilia B, cystic fibrosis and spinal muscular atrophy (SMA), respectively, and the therapeutic splicing rescue by using U1 small nuclear RNA (snRNA). In minigene expression systems, loading of U1 snRNA by complementarity to the normal or mutated donor splice sites (5′ss) corrected the exon skipping caused by mutations at the polypyrimidine tract of the acceptor splice site, at the consensus 5′ss or at exonic regulatory elements. To improve specificity and reduce potential off-target effects, we developed U1 snRNA variants targeting non-conserved intronic sequences downstream of the 5′ss. For each gene system, we identified an exon-specific U1 snRNA (ExSpeU1) able to rescue splicing impaired by the different types of mutations. Through splicing-competent cDNA constructs, we demonstrated that the ExSpeU1-mediated splicing correction of several F9 mutations results in complete restoration of secreted functional factor IX levels. Furthermore, two ExSpeU1s for SMA improved SMN exon 7 splicing in the chromosomal context of normal cells. We propose ExSpeU1s as a novel therapeutic strategy to correct, in several human disorders, different types of splicing mutations associated with defective exon definition.

Mcl-1 protein affects mitochondrial calcium homeostasis to modulate apoptosis. Mcl-1 is involved in mitochondrial fusion and fission in a Drp1-dependent manner By using splicing-switching antisense oligonucleotides, it is possible to increase the synthesis of the Mcl-1 proapoptotic isoform, increasing the sensitivity of cancer cells to apoptotic stimuli.

Small nuclear U1-RNAs (snRNAs), the spliceosome components selectively recognizing donor splice sites (5ss), were engineered to restore correct mRNA processing in a cellular model of severe coagulation factor VII (FVII) deficiency, caused by the IVS7 9726 ؉ 5g/a change. Three U1-snRNAs, complementary to the mutated 5ss (U1 ؉ 5a) or to neighboring sequences were expressed with FVII minigenes in a hepatoma cell line. The U1-snRNAs reduced from 80% to 40% the exon 7 skipping, thus increasing exon definition. The U1 ؉ 5a construct also dramatically increased recognition of the correct 5ss over the 37-bp downstream cryptic site preferentially activated by the mutation, thus inducing appreciable synthesis of normal transcripts (from barely detectable to 50%). This effect, which was dose-dependent, clearly demonstrated that impaired recognition by the U1-snRNA was the mechanism responsible for FVII deficiency. These findings suggest compensatory U1-snRNAs as therapeutic tools in coagulation factor deficiencies caused by mutations at 5ss, a frequent cause of severe defects. IntroductionChanges affecting mRNA processing represent a frequent cause of severe coagulation factor defects 1-6 and of all inherited human diseases. 7-9 Different from gene therapy approaches inserting exogenous sequences that drive the expression of the missing factor, the specific correction of the mRNA processing would maintain the proper transcriptional control at the natural chromosomal environment and restore gene expression.Modified small nuclear RNAs (snRNAs) have been shown to promote changes in mRNA splicing in cellular and animal models of human diseases. However, these approaches were mainly aimed at inducing skipping of defective exons, 10,11 an approach that would not produce functional coagulation proteins, or masking newly generated cryptic exons, 12-14 an uncommon event in coagulation factor defects. Few attempts 15,16 have been made to redirect recognition of mutated donor splice site (5Јss) consensus sequences, the most frequent target in human disease genes. 8 On the other hand, bleeding disorders would significantly benefit even from low production of the correct mRNA and protein.As a model to exploit snRNAs for restoration of correct splicing in coagulation factor deficiencies, we chose the 9726 ϩ 5g/a mutation 17 in FVII occurring in the donor splice site of intron 7 (IVS7) at the ϩ 5 position, whose substitution has been frequently found to be associated with human diseases. [7][8][9] The homozygous patients experienced life-threatening hemorrhagic symptoms and require replacement therapy. Interestingly, coinheritance of the FVLeiden allele in a 9726 ϩ 5g/a homozygote produced a small increase in factor Xa and thrombin generation, resulting in a mild bleeding phenotype. 18 Through expression of minigenes and use of U1-snRNAs designed to selectively target the mutated site, we provided evidence for partial restoration of factor VII (FVII) mRNA processing impaired by the 9726 ϩ 5g/a change. Methods Construction of plasmidsThe...

Mutations that result in amino acid changes can affect both pre-mRNA splicing and protein function. Understanding the combined effect is essential for correct diagnosis and for establishing the most appropriate therapeutic strategy at the molecular level. We have identified a series of disease-causing splicing mutations in coagulation factor IX (FIX) exon 5 that are completely recovered by a modified U1snRNP particle, through an SRSF2-dependent enhancement mechanism. We discovered that synonymous mutations and missense substitutions associated to a partial FIX secretion defect represent targets for this therapy as the resulting spliced-corrected proteins maintains normal FIX coagulant specific activity. Thus, splicing and protein alterations contribute to define at the molecular level the disease-causing effect of a number of exonic mutations in coagulation FIX exon 5. In addition, our results have a significant impact in the development of splicing-switching therapies in particular for mutations that affect both splicing and protein function where increasing the amount of a correctly spliced protein can circumvent the basic functional defects.

Mutations affecting specific splicing regulatory elements offer suitable models to better understand their interplay and to devise therapeutic strategies. Here we characterize a meaningful splicing model in which numerous Hemophilia B-causing mutations, either missense or at the donor splice site (5′ss) of coagulation F9 exon 2, promote aberrant splicing by inducing the usage of a strong exonic cryptic 5′ss. Splicing assays with natural and artificial F9 variants indicated that the cryptic 5′ss is regulated, among a network of regulatory elements, by an exonic splicing silencer (ESS). This finding and the comparative analysis of the F9 sequence across species showing that the cryptic 5′ss is always paralleled by the conserved ESS support a compensatory mechanism aimed at minimizing unproductive splicing. To recover splicing we tested antisense oligoribonucleotides masking the cryptic 5′ss, which were effective on exonic changes but promoted exon 2 skipping in the presence of mutations at the authentic 5′ss. On the other hand, we observed a very poor correction effect by small nuclear RNA U1 (U1snRNA) variants with increased or perfect complementarity to the defective 5′ss, a strategy previously exploited to rescue splicing. Noticeably, the combination of the mutant-specific U1snRNAs with antisense oligonucleotides produced appreciable amounts of correctly spliced transcripts (from 0 to 20–40%) from several mutants of the exon 2 5′ss. Based on the evidence of an altered interplay among ESS, cryptic and the authentic 5′ss as a disease-causing mechanism, we provide novel experimental insights into the combinatorial correction activity of antisense molecules and compensatory U1snRNAs.

The c.2101A>G synonymous change (p.G674G) in the gene for ATR, a key player in the DNA-damage response, has been the first identified genetic cause of Seckel Syndrome (SS), an orphan disease characterized by growth and mental retardation. This mutation mainly causes exon 9 skipping, through an ill-defined mechanism. Through ATR minigene expression studies, we demonstrated that the detrimental effect of this mutation (6±1% of correct transcripts only) depends on the poor exon 9 definition (47±4% in the ATR context), because the change was ineffective when the weak 5' or the 3' splice sites (ss) were strengthened (scores from 0.54 to 1) by mutagenesis. Interestingly, the exonic c.2101A nucleotide is conserved across species, and the SS-causing mutation is predicted to concurrently strengthen a Splicing Silencer (ESS) and weaken a Splicing Enhancer (ESE). Consistently, the artificial c.2101A>C change, predicted to weaken the ESE only, moderately impaired exon inclusion (28±7% of correct transcripts). The observation that an antisense oligonucleotide (AON) targeting the c.2101A position recovers exon inclusion in the mutated context supports a major role of the underlying ESS. A U1snRNA variant (U1) designed to perfectly base-pair the weak 5'ss, rescued exon inclusion (63±3%) in the ATR-allele. Most importantly, upon lentivirus-mediated delivery, the U1 partially rescued ATR mRNA splicing (from ~19% to ~54%) and protein (from negligible to ~6%) in embryonic fibroblasts derived from humanized ATR mice. Altogether these data elucidate the molecular mechanisms of the ATR c.2101A>G mutation and identify two potential complementary RNA-based therapies for Seckel syndrome.

Our previous studies with genomic minigenes have demonstrated that an engineered small nuclear RNA-U1 (U1؉5a) partially rescued coagulation factor VII (FVII) mRNA processing impaired by the 9726؉5G>A mutation. Here, to evaluate the U1؉5a effects on FVII function, we devised a full-length FVII splicingcompetent construct (pSCFVII-wt). This construct drove in COS-1 cells the synthesis of properly processed FVII transcripts and of secreted functional FVII (23 ؎ 4 ng/ mL), which were virtually undetectable upon introduction of the 9726؉5G>A mutation (pSCFVII-9726؉5a). Cotransfection of pSCFVII-9726؉5a with pU1؉5a resulted in a partial rescue of FVII splicing and protein biosynthesis. The level increase in medium was dose dependent and, with a molar excess (1.5؋) of pU1؉5a, reached 9.5% plus or minus 3.2% (5.0 ؎ 2.8 ng/mL) of FVII-wt coagulant activity. These data provide the first insights into the U1-snRNA-mediated rescue of donor splice sites at protein level, thus further highlighting its therapeutic implications in bleeding disorders, which would benefit even from tiny increase of functional levels. (Blood. 2009;113: 6461-6464) IntroductionThe elucidation of molecular mechanisms underlying aberrant mRNA processing, a frequent cause of all inherited human disorders, 1-2 has provided the rationale for RNA-based correction strategies that offer several advantages over the gene replacement therapy methods, including maintenance of the proper transcriptional control of the disease gene.The vast majority of RNA-based approaches have exploited, in vitro and in vivo, antisense sequences to either mask natural splice sites, to induce skipping of defective exons, 3-5 or newly generated cryptic sites, 3,[6][7][8] to favor the use of the canonical ones. Only a few attempts [9][10][11][12] have been made to restore gene expression impaired by mutations at canonical donor splice sites (5'ss), which are the most frequent targets in human disease genes, 1 including coagulation factor genes. 13-18 Although we 10-12 and others 9 have partially restored correct splicing using the small nuclear RNA U1 (U1-snRNA), 19 the experimental settings did not allow the assessment of rescue at protein and function levels, the key issue for the evaluation of the therapeutic potential.Here, by exploiting a splicing-competent full-length construct, and thus a novel cellular model of severe coagulation factor VII (FVII) deficiency caused by the IVS7 9726ϩ5GϾA mutation, 20 we demonstrated that the U1-snRNA-mediated rescue of FVII mRNA processing eventually results in an appreciable secretion of functional FVII. Methods Creation of vectorsExpression vectors for the secreted human FVII 21 and for the parental (pU1-wt) and mutated (pU1ϩ5a) human U1-snRNA 11 were available in the laboratory.To create the full-length splicing-competent constructs, the FVII gene region spanning exons 6 through 8 (nt's 8926-11157) 22 from our previously prepared wild-type and mutated minigene constructs 11 was amplified with primers 5Ј GCATCTTTCTGACTTTTGTT 3Ј (forward) a...

Pre-peptide regions of secreted proteins display wide sequence variability, even among highly homologous proteins such as coagulation factors, and are intracellularly removed, thus potentially favoring secretion of wild-type proteins upon suppression of nonsense mutations (translational readthrough). As models we selected F9 nonsense mutations with readthrough-favorable features affecting the pre-peptide and pro-peptide regions of coagulation factor IX (FIX), which cause hemophilia B (HB). Only the p.Gly21Ter (c.61G > T) in the variable pre-peptide hydrophobic core significantly responded (secretion, 4.1 ± 0.5% of wild-type; coagulant activity, 4.0 ± 0.3%) to the readthrough-inducer geneticin. Strikingly, for the p.Gly21Ter mutation, the resulting specific coagulant activity (0.96 ± 0.11) was compatible with normal function, thus suggesting secretion of FIX with wild-type features upon readthrough and removal of pre-peptide. Expression of the predicted readthrough-deriving missense variants (Gly21Trp/Cys/Arg) revealed a preserved specific activity (ranging from 0.84 to 0.98), thus supporting our observation. Conversely, rescue of the p.Cys28Ter (c.84T > A) and p.Lys45Ter (c.133A > T) was prevented by constraints of adjacent cleavage sites, a finding consistent with the association of most missense mutations affecting these regions with severe or moderate HB. Overall, our data indicate that suppression of nonsense mutations in the pre-peptide core preserves mature protein features, thus making this class of mutations preferred candidates for therapeutic readthrough.