Four tomato lines introgressed from Lycopersicon chilense were compared with the commercial F 1 hybrids ÔARO 8479Õ and ÔHA 3108Õ, which are tolerant to Tomato yellow leaf curl virus, and the cv. ÔCampbell 28Õ as a susceptible control. Resistance was evaluated by the use of grafted diseased scions as well as in a field trial where plants infected by viruliferous whiteflies and disease-free plants were transplanted in paired rows. The new lines LD 3, LD 4, LD 5 and LD 6 showed no disease symptoms after grafting or in the field trial. Virus accumulation at 60 days after transplanting was low in the infected plants: 0.09, 0.60, 1.00 and 0.50 ng, respectively. No fruit-set or yield losses were registered under the high temperature conditions prevalent in the trial, in which lines LD 5 and LD 6 were better adapted to tropical conditions. Viral DNA concentrations were over 1000 ng in the cvs. ÔCampbell 28Õ, ÔARO 8479Õ and ÔHA 3108Õ. The last two are considered tolerant as they were asymptomatic or had mild symptoms, respectively, but achieved acceptable yields in the trial. By contrast, virus had a negative effect on fruit-set, number of fruit per plant and total yield in the cv. ÔCampbell 28Õ.
The begomovirus Tomato yellow leaf curl virus (TYLCV) is one of the major threats to tomato production in tropical and subtropical regions worldwide. TYLCV was found in Cuba in 1994 and later became the most serious constraint to tomato production (2). During a field survey in 2001, pepper plants (Capsicum annuum) were observed in a greenhouse in Camagüey Province, showing mild interveinal yellowing and curling of leaves. Total nucleic acids were extracted from these plants and from pepper samples collected in previous years that showed similar symptoms. Polymerase chain reaction (PCR) was performed on extracts using a primer pair (TY-1/TY-2) (1) specific for the capsid protein (CP) gene of begomoviruses and a second primer pair (IR2353+: CTGAATGTTTGGATGGAAATGTGC; IR255-:GCTCGTAAGTTTCCT CAACGGAC) designed to amplify the part of the genome encompassing the intergenic region (IR) of the Cuban isolate of TYLCV-IS (2). With these primer pairs, amplicons of the expected size were obtained from five samples (one collected in 1995 in Havana Province, two in 1999 in Sancti Spiritus, and two in 2001 in Camagüey.) The CP fragment was digested with RsaI, while the IR amplicon was digested with AvaII and EcoRI. In all cases the patterns obtained corresponded to digestion patterns for identical PCR fragments obtained from TYLCV-infected tomatoes. The IR amplicon sequence from one sample showed ≈99% identity with the corresponding region of the TYLCV-IS isolated from tomato in Cuba. To our knowledge, this is the first report of TYLCV-IS infection in peppers in Cuba. References: (1) G. P. Accotto et al. Eur. J. Plant. Pathol. 106:179, 2000. (2) Y. Martínez et al. J. Phytopathol.144:277, 1996.
Beans with yellow mosaic and/or leaf crumple symptoms were collected in three fields in the southern area of the province of Havana, Cuba in December 2001 and February 2002. DNA was extracted from the fresh bean leaves of 25 samples (1). Dot blot hybridization was performed at high stringency with a specific probe for Tomato yellow leaf curl virus (TYLCV). The specific probe was prepared by alkaline phosphatase labeling of the polymerase chain reaction (PCR) fragment amplified with primer pair, PTYIRv21/PTYIRc287, containing the intergenic region (IR) of TYLCV, and chemiluminescent hybridization was completed as described by the manufacturer (AlkPhos Direct Labeling and Detection Systems, Amersham Pharmacia Biotech Inc., Piscataway, NJ). Four of the samples had positive hybridization signals. PCR was performed with overlapping primers for TYLCV (2) with the DNA extract from sample 01–44, which gave a positive hybridization signal with the TYLCV probe, and a 2.8-kb fragment was obtained. This fragment was cloned in pGem T-Easy (pBeTY44) and partially sequenced. Greater than 96% nt identity was obtained for the 591 nt of the IR and 504 nt of the N-terminus of the Rep gene with TYLCV (GenBank Accession No. AF260331). Also, PCR was completed on 11 of the 25 samples with the degenerate primer pair PAL1v1978/PAR1c715 for DNA-A (3). Eight samples gave fragment sizes of 1.4 kb and one sample gave a fragment of 1.3 kb. The 1.3-kb fragment from sample number 01–50 was cloned in pGem T-Easy (pBeBG50) and partially sequenced. Pairwise nucleotide comparisons with Bean golden yellow mosaic virus (BGYMV, GenBank Accession No. M91604) were 95% for 719 nt of the N-terminus of the Rep gene. These results are consistent with the association of both TYLCV and BGYMV in beans and have important implications for future disease management strategies. References: (1) G. P. Accotto et al. Eur. J. Plant. Pathol. 106:179, 2000. (2) M. K. Nakhla et al. Plant Dis. 78:926, 1994. (3) M. Rojas et al. Plant Dis. 77:340, 1993.
RESUMO: Realizou-se neste trabalho o levantamento fitossociológico em matas de galeria inundáveis com o objetivo de avaliar a composição florística, similaridade e relação da distribuição da comunidade com as variáveis ambientais. A diversidade alfa foi avaliada por meio do cálculo do índice de Shannon – Wienner (H’) e do índice de eqüabilidade de Pielou (J’). A diversidade beta entre os trechos de mata foi verificada pelo cálculo do índice de similaridade de Sorensen - “Bray-Curtis”. Para relacionar a comunidade com as variáveis ambientais, foram coletadas amostras de solos para análise química e física, dados de umidade do solo e de sombreamento nas parcelas pelo método de Braun-blanquet. Para verificar a correlação entre a distribuição das espécies e as variáveis ambientais e espaciais, foi feita a Análise Canônica de Redundância (RDA). A espécie que teve maior valor de importância foi a Richeria grandis Vahl. O índice de Shannon-Weiner (H’) variou de 2,47 a 2,84 nats.ind-1, correlacionado à baixa dominância ecológica (alta equabilidade de Pielou (J’): 0,88 a 0,81). O índice de Bray-Curtis revelou baixa similaridade florística, elevada diversidade beta. Análises da RDA revelaram que variações na vegetação foram pouco explicadas (14%) pelo ambiente e pelo espaço. A grande proporção não explicada (86%) reforça a ideia de que padrões estocásticos, preconizados pela Teoria Neutra, podem prevalecer sobre os ambientais na estruturação destas matas de galeria. PALAVRAS-CHAVE: Análise multivariada, ilhas florestais, conservação ecológica, Serra do Espinhaço.
O estudo teve como objetivo compreender a fenologia reprodutiva e vegetativa da espécie Vellozia ramosissima, associando o padrão fenológico às variações sazonais características do ambiente. O estudo foi realizado em áreas do complexo rupestre quartzítico e ferruginoso no município de Conceição do Mato Dentro, MG. Foram observadas mensalmente as características fenológicas de vinte plantas, no período de jul/2015 a jul/2016. Foram utilizados dados meteorológicos de precipitação, temperatura, umidade e velocidade do vento para o período de estudo. O padrão fenológico foi determinado pelo método de intensidade de Fournier, correlação de Spearman e análise circular. Foram encontradas correlações significativas entre as fenofases e as variáveis abióticas apenas para dispersão dos frutos e produção de folhas novas. A espécie apresentou um comportamento fenológico bastante sazonal para maior parte dos eventos, reflexo da sazonalidade climática, característica da região de estudo. Foram observados padrões distintos entre as áreas para todas as fenofases avaliadas.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.