These data not only demonstrated SAA was useful in predicting survival of patients with gastric cancer, but they also showed that SAA was a valuable tool for postoperative follow-up.

Matriptase, a transmembrane serine protease, is broadly expressed by, and crucial for the integrity of, the epithelium. Matriptase is synthesized as a zymogen and undergoes autoactivation to become an active protease that is immediately inhibited by, and forms complexes with, hepatocyte growth factor activator inhibitor (HAI-1). To investigate where matriptase is activated and how it is secreted in vivo, we determined the expression and activation status of matriptase in seminal fluid and urine and the distribution and subcellular localization of the protease in the prostate and kidney. The in vivo studies revealed that while the latent matriptase is localized at the basolateral surface of the ductal epithelial cells of both organs, only matriptase-HAI-1 complexes and not latent matriptase are detected in the body fluids, suggesting that activation, inhibition, and transcytosis of matriptase would have to occur for the secretion of matriptase. These complicated processes involved in the in vivo secretion were also observed in polarized Caco-2 intestinal epithelial cells. The cells target latent matriptase to the basolateral plasma membrane where activation, inhibition, and secretion of matriptase appear to take place. However, a proportion of matriptase-HAI-1 complexes, but not the latent matriptase, appears to undergo transcytosis to the apical plasma membrane for secretion. When epithelial cells lose their polarity, they secrete both latent and activated matriptase. Although most epithelial cells retain very low levels of matriptase-HAI-1 complex by rapidly secreting the complex, gastric chief cells may activate matriptase and store matriptase-HAI-1 complexes in the pepsinogen-secretory granules, suggesting an intracellular activation and regulated secretion in these cells. Taken together, while zymogen activation and closely coupled HAI-1-mediated inhibition are common features for matriptase regulation, the cellular location of matriptase activation and inhibition, and the secretory route for matriptase-HAI-1 complex may vary along with the functional divergence of different epithelial cells.

Aim: To investigate the role of hTERT gene expression and AP-2α in n-butylidenephthalide (n-BP)-induced apoptosis in A549 lung cancer cells. Methods: Viability of A549 cells was measured by MTT assay. Protein expression was determined by Western blot. Telomerase activity was measured using the modified telomere repeat amplification protocol (TRAP) assay. Xenograft mice were used as a model system to study the cytotoxic effect of n-BP in vivo. The morphology of tumor was examined by immunohistochemical staining. Results: The growth of A549 lung cancer cells treated with n-BP was significantly inhibited. Telomerase activity and hTERT mRNA expression were determined by telomeric repeat amplification protocol and reverse transcription-polymerase chain reaction, respectively. n-BP inhibited telomerase activity and hTERT mRNA expression in A549 cells while overexpression of hTERT could abolish BPinduced growth inhibition in the A549 cells. We also showed that hTERT promoter activity in the presence of n-BP was mediated via AP-2α. We saw an inhibition of tumor growth when nude mice carrying A549 subcutaneous xenograft tumors were treated with n-BP. Immunohistochemistry of this tumor tissue also showed a decrease in the expression of hTERT. Conclusion: The antiproliferative effects of n-BP on A549 cells in vitro and in vivo suggest a novel clinical application of this compound in the treatment of lung cancers.

No abstract

Matriptase, a type 2 transmembrane serine protease, and its inhibitor hepatocyte growth factor activator inhibitor (HAI)-1 are required for normal epidermal barrier function, and matriptase activity is tightly regulated during this process. We therefore hypothesized that this protease system might be deregulated in skin disease. To test this, we examined the level and activation state of matriptase in examples of 23 human skin disorders. We first examined matriptase and HAI-1 protein distribution in normal epidermis. Matriptase was detected at high levels at cell-cell junctions in the basal layer and spinous layers but was present at minimal levels in the granular layer. HAI-1 was distributed in a similar pattern, except that high-level expression was retained in the granular layer. This pattern of expression was retained in most skin disorders. We next examined the distribution of activated matriptase. Although activated matriptase is not detected in normal epidermis, a dramatic increase is seen in keratinocytes at the site of inflammation in 16 different skin diseases. To gain further evidence that activation is associated with inflammatory stimuli, we challenged HaCaT cells with acidic pH or H2O2 and observed matriptase activation. These findings suggest that inflammation-associated reactive oxygen species and tissue acidity may enhance matriptase activation in some skin diseases.

Enterogastric reflux (EGR) is regarded as an unavoidable consequence of distal gastrectomy. We evaluated the efficacy of Roux-en-Y (RY) gastrojejunostomy and Braun enteroenterostomy (BEE) for preventing EGR. Between January 2002 and January 2005, 60 patients who underwent distal gastrectomy for gastric cancer or peptic ulcers were divided into RY, Billroth II reconstruction (BII) without or with BEE (BII+B) according to reconstructive method. After 12 months, EGR and mucosal alterations of the remnant stomach were evaluated using biliary scintigraphy, endoscopy, and histology. Scintigraphy showed fasting and postprandial EGR into the remnant stomach occurred in 5.3% and 21.1% of the RY group, 62.1% and 93.1% of the BII group, and 50.0% and 91.7% of the BII+B group, respectively. Endoscopy showed bile reflux occurred in 15.8% of the RY group, 75.9% of the BII group, and 83.3% of the BII+B group. In addition, the prevalence of Helicobacter pylori (HP) infection in the RY group was less than in the other groups (P<0.02). Therefore, RY after distal gastrectomy was effective in reducing EGR and HP infection. BEE was ineffective in diverting bile flow away from the gastric remnant.

Prion diseases (also known as transmissible spongiform encephalopathies) are associated with the conversion of the normal cellular form of the prion protein (PrPC) to an abnormal scrapie-isoform (PrP(Sc). The conversion of PrP(C) to PrP(Sc) is post-translational and is owing to protein conformational change. This has led to the hypothesis that molecular chaperones may be involved in the folding of prion proteins, and hence the disease process. By treating human NT-2 cells with heat-shock stress, we found that both the mRNA levels for prion protein (PrP) and heat shock protein 70 (HSP70) increased simultaneously after heat treatment. Western-blot analysis of PrP also showed a two-fold increase in PrP protein level 3 after heat treatment. Furthermore, two heat-shock elements (HSEs) were located at the positions of -680 bp (HSE1; GGAACTATTCTTGACATTGCT), and -1653 bp (HSE2; TGAGAACTCAGGAAG) of the rat PrP (RaPrP) gene promoter. Luciferase reporter constructs of the RaPrP promoter with HSE expressed higher luciferase activity (10- to 15-fold) than those constructs without HSE. Electrophoretic gel mobility shift assay (EMSA) and super-shift assay confirmed the interaction of HSE1 and HSE2 with the heat-shock transcription factor-1 (HSTF-1). These results suggest that cellular stress up-regulates both the transcription and translation of PrP through interaction with the HSEs on the PrP gene promoter, resulting in an increase in protein synthesis.

Background: We aimed to evaluate the effect of early pelvic binder use in the emergency management of suspected pelvic trauma, compared with the conventional stepwise approach. Methods: We enrolled trauma patients with initial stabilization using a pelvic binder when suspecting pelvic injury. The inclusion criteria were traumatic injury requiring a trauma team and at least one of the following: a loss of consciousness or a Glasgow coma score (GCS) of <13; systolic blood pressure of <90 mmHg; falling from ≥6 m; injury to multiple vital organs; and suspected pelvic injury. Various parameters, including gender, age, mechanism of injury, GCS, mortality, hospital stay, initial vital signs, revised trauma score, injury severity score, and outcome, were assessed and compared with historical controls. Results: A total of 204 patients with high-energy multiple-trauma from a single level I trauma center in North Taiwan were enrolled in the study from August 2013 to July 2014. The two group baseline patient characteristics were all collected and compared. The trauma patients with suspected pelvic fractures initially stabilized with a pelvic binder had shorter hospital and intensive care unit (ICU) stays. The study group achieved statistically significantly improved survival and lower mean blood transfusion volume and mortality rate, although they were more severe in the trauma score. Conclusions: We recommend prompt pelvic binder use for suspected pelvic injury before definitive imaging is available, as a cervical spine collar is used to protect the cervical spine from further injury prior to definitive identification and characterization of an injury.