BACKGROUND Licorice-induced severe hypokalemic rhabdomyolysis is clinically rare. Gitelman syndrome (GS) is the most common inherited renal tubular disease, while diabetes is one of the most prevalent diseases in the world. Recently, some studies have found that GS patients had higher diabetic morbidity. However, the coexistence of these three diseases has yet to be reported. CASE SUMMARY We report the case of a 62-year-old Chinese man who was admitted with weakness in the extremities, muscle pain, and dark-colored urine. He had consumed liquorice water daily for seven days prior to admission. The laboratory tests revealed a serum potassium level of 1.84 mmol/L, magnesium 0.68 mmol/L, creatinine phosphokinase (CK) 10117 IU/L, and marked hemoglobinuria. Fractional chloride excretion and fractional magnesium excretion were increased. Plasma renin activity and aldosterone concentration were within the normal ranges. Sequence analysis of the SLC12A3 gene revealed that he had compound heterozygous mutations. The diagnosis of liquorice-induced severe hypokalemic rhabdomyolysis with GS and diabetes was thus genetically confirmed. Serum potassium and CK quickly improved with potassium replacement therapy, hydration, and discontinuation of liquorice ingestion. Upon follow-up at 3 mo, the levels of CK, myoglobin, and potassium remained normal, and magnesium was above 0.6 mmol/L. CONCLUSION This case emphasizes that liquorice consumption and GS should be considered causes of hypokalemia and that the diabetic status of GS patients should be noted in the clinic.

No abstract

Here, we report a case of a patient with symptoms of Cushing syndrome, who is diagnosed with primary generalized glucocorticoid hypersensitivity in the end. The patient's relevant laboratory tests and imaging examinations are described. Mifepristone, a glucocorticoid receptor antagonist, was prescribed and its therapeutic effect on the patient's electrolyte level, lipid metabolism, and bone metabolism was observed during the treatment. The endocrine assessment indicated normal pituitary-adrenal axis regulation function but reduced cortisol secretion. Quantitative reverse transcription-polymerase chain reaction indicated reduced mRNA level of mineralocorticoid receptor gene. Pituitary magnetic resonance imaging showed normal pituitary anatomy, while adrenal computed tomography scan showed bilateral adrenal atrophy and increased content of visceral and abdominal subcutaneous fat. Moreover, chromosome examination revealed a normal 46, XY chromosome. In this case, mifepristone was administered to treat primary generalized glucocorticoid hypersensitivity. To the best of our knowledge, there are a few reports on mifepristone-treated primary generalized glucocorticoid hypersensitivity. In the one-year follow-up visits, the evaluated results of electrolyte level, lipid metabolism, and bone metabolism indicated that the patient's symptoms resulting from cortisol hypersensitivity were relieved progressively.

Rationale:Acute intermittent porphyria (AIP) is caused by hydroxymethylbilane synthase (HMBS) gene mutation.Patient concerns:A Chinese female patient with very typical AIP symptoms of severe abdominal pain, seizures, hypertension, and tachycardia, accompanied with hyponatremia, anemia, and hyperbilirubinemia.Diagnoses:She was diagnosed as AIP based on positive result of urine porphobilinogen and her clinical syndrome.Interventions:The proband was treated with intravenous glucose (at least 250 g per day) for 4 days. HMBS mutation was investigated in this family by Sanger sequencing.Outcomes:A heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. The mutation has not been documented in current gene databases. Further prediction of mutated protein structure suggests that the mutation is likely to produce prolonged peptide with structural change and less stability.Lessons:Physicians should pay attention to AIP attack in patients with suspected symptoms and make use of genetic testing to increase identification of mutated HMBS gene carriers for further preventive strategy.

No abstract