Pitaya (Selenicereus costaricensis), a tropical and subtropical fruit of Cactaceae family, become very popular in the fruit consumer market in recent years. In June 2022, plant stunting, reduced yields and galled root symptoms were observed on S. costaricensis plants sampled from a commercial production base in Wuming County (23°10′36.67″ N; 108°40′43.24″ E), Guangxi autonomous region, China. The area of S. costaricensis field we investigated was about 19.9 ha. The incidence of root-knot nematode disease was almost 60%. Roots of twenty S. costaricensis plants were dug up, and many root knots and egg masses were observed. The roots with galls were collected, nematodes at different stages were collected and morphologically identified. Females were annulated, pearly white and globular to pear-shaped. The perineal pattern was oval shaped with the dorsal arch being moderately high to high. Average length of adult females (n = 20): body = 614.4 ± 57.3 μm, stylet lengths = 15.1 ± 0.9 μm, dorsal esophageal gland orifice (DGO) = 4.7 ± 0.6 μm. The tail of the second stage juvenile (J2) was very thin with a bluntly pointed tip. The hyaline tail terminus was clearly defined. Average length of J2 (n = 20): body = 469.5 ± 36.7 μm, stylet lengths = 14.7 ± 0.5 μm, DGO = 3.5 ± 0.4 μm, tail lengths averaged = 43.6 ± 9.7 μm. The males were vermiform, annulated, slightly tapering anteriorly, bluntly rounded posteriorly. Typical characteristics of Meloidogyne enterolobii observed were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from an individual egg mass were collected for DNA extraction and used for molecular biological identification. The specific primers of M. enterolobii, Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), was used to validate the pathogen (Long et al. 2006). Approximately 236 bp of the target product was amplified, whereas no product was obtained from M. incognita. Further, the rDNA gene sequences (ITS; ITS1_5.8S_ITS2) and large subunit rDNA gene were amplified by the primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Subbotin et al. 2006). The target sequences of 765 bp (GenBank accession no. OQ512155) and 759 bp (OQ512743) were recorded in the NCBI with GeneBank. The sequences showed 100% identity with M. enterolobii in ITSs (KJ146863, JQ082448) and D2/D3 (MF467276, OL681885). To verify reproduction on S. costaricensis (Jindu 1), twelve ten-week-old seedlings (12 pots) cultured on a sterile substrate soil were inoculated with 5,000 J2s from the original population in a greenhouse at 26 ˚C. Noninoculated control were set up at the same time. After 8 weeks, the noninoculated plants (n = 12) did not present galls in the roots. All inoculated plants had galled roots and showed dwarf plant. The average reproductive factor obtained was 11.6 and the mean root gall rating of the samples was 5.3 (rating scale of 0 to 10), confirming the pathogenicity of M. enterolobii to S. costaricensis. The red dragon fruits (Hylocereus polyrhizus) in Hainan Island (China) were reported infected by M. enterolobii in previous report (Long et al. 2022). To our knowledge, this is the first report of M. enterolobii parasitizing S. costaricensis in Guangxi, China. This finding has important implications for the control of M. enterolobii at the place of discovery, which is the major fruit production area.
Mesona chinensis Benth is a perennial herb of edible and medicinal value. It is commonly used to cure heatstroke and fever, and treat diseases including diabetes, hypertension, and acute nephritis in modern medicine (Li et al. 2020). In May 2020, M. chinensis plants presented reduced growth and leaf wilting associated with root galls at agricultural base of Guangxi University (22°50′28.41″ N, 108°17′9.00″ E), China. Digging up the roots of the M. chinensis plants revealed lots of root knots. Eggs and second-stage juveniles (689 ± 28) of Meloidogyne spp. were collected in per gram fresh weight roots. Population densities of the J2s averaged 386 ±16 per 100 cm3 soil. The female perineal pattern is usually oval shaped with the dorsal arch being moderately high to high and often rounded. The J2s are truncate with head region rounded and body slender. Tails are narrow with pointed tips, and distinct hyaline tail termini. The morphological measurements (mean, standard deviation and range) of the females (n=10) measurements were: body length = 689.7 ± 11.5 μm; width = 549.3 ± 42.9 μm; stylet length = 15.1 ± 1.0 μm; dorsal esophageal gland orifice (DGO) = 5.4 ± 0.5 μm. The males (n=12) measurements were: body length = 1,341.0 ± 96.2 μm; width =38.6 ± 4.2 μm; DGO = 4.4 ± 0.1 μm. The J2 (n=20) were: body length = 436.1 ± 12.5 μm; body width = 15.7 ± 0.8 μm; stylet length = 12.4 ± 0.8 μm; DGO = 3.8 ± 0.3 μm. Individual J2 (n=4) DNA was further explored by using the primers 18S/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG), C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT), and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA) (Vrain et al. 1992; Powers and Harris 1993; Nadler et al. 1999). Three fragments 765 bp (GenBank accession no. OL663830), 705 bp (OL780766), and 759 bp (OL681885) were amplified, are 100% sequence homology with M. enterolobii (MT406251, MN269947, MT193450), respectively. Species-specific primers Me-F/Me-R were used for amplification of rDNA-IGS2. An expected PCR fragment of approximately 236 bp was obtained, but not presented in M. incognita populations (Long et al. 2006). Therefore, the unknown nematode was further identified as M.enterolobii. To perform Koch’s postulates, M. enterolobii from M. chinensis roots were inoculated onto tomato plants for propagation and eggs were extracted from tomato roots. Greenhouse tests were conducted after inoculating 0 or 5,000 eggs into M. chinensis one-month-old healthy cuttings grown in pots filled with sterilized substrates. After 60 days, the inoculated plants (n=12) exhibited galled root symptoms and the noninoculated ones (n=10) exhibited no galls. A reproduction factor of 13.2 ± 3.3 was obtained, confirming the pathogenicity of M. enterolobii on M.chinesis. To our knowledge, this is the first report of a natural infection of M. enterolobii on M.chinensis. It is likely that M. enterolobii may be causing a high level of loss on M. chinensis in southern China.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.