Pure ices of amorphous methanol, CH 3 OH(X 1 A 0 ), were irradiated at 11 K by 5 keV electrons at 100 nA for 1 hr. These energetic electrons simulate electronic energy transfer processes that occur as interstellar ices, comets, and icy solar system bodies are subjected to irradiation from MeV ions and secondary electrons produced in this process. The results were analyzed quantitatively via absorption-reflection-absorption Fourier transform infrared ( FTIR) spectroscopy, with the identification of new species aided by high-level electronic structure calculations. The unimolecular decomposition of methanol was found to proceed via the formation of (1) the hydroxymethyl radical, CH 2 OH(X 2 A 00 ), and atomic hydrogen, H( 2 S 1=2 ), (2) the methoxy radical, CH 3 O(X 2 A 0 ), plus atomic hydrogen, (3) formaldehyde, H 2 CO(X 1 A 1 ) plus molecular hydrogen, H 2 (X 1 AE þ g ), and (4) the formation of methane, CH 4 (X 1 A 1 ), together with atomic oxygen, O( 1 D). The accessibility of the last channel indicates that the reverse process, oxygen addition into methane to form methanol, should also be feasible. A kinetic model is presented for the decomposition of methanol into these species, as well as the formyl radical, HCO(X 2 A 0 ), and carbon monoxide, CO(X 1 AE þ ). During the subsequent warming up of the sample, radicals previously generated within the matrix were mobilized and found to recombine to form methyl formate, CH 3 OCHO(X 1 A 0 ), glycolaldehyde, CH 2 OHCHO(X 1 A 0 ), and ethylene glycol, HOCH 2 CH 2 OH(X 1 A). Upper limits for the production of these species by the recombination of neighboring radicals produced during irradiation as well as during the warm-up procedure are presented. The generation of these molecules by irradiation of ices in the solid state and their subsequent sublimation into the gas phase can help explain their high abundances as observed toward hot molecular cores and underlines their importance in astrobiology.

We present a joint crossed molecular beam and kinetics investigation combined with electronic structure and statistical calculations on the reaction of the ground-state cyano radical, CN(X 2 Σ +), with the 1,3-butadiene molecule, H 2 CCHCHCH 2 (X 1 A g), and its partially deuterated counterparts, H 2 CCDCDCH 2 (X 1 A g) and D 2 CCHCHCD 2 (X 1 A g). The crossed beam studies indicate that the reaction proceeds via a long-lived C 5 H 6 N complex, yielding C 5 H 5 N isomer(s) plus atomic hydrogen under single collision conditions as the nascent product(s). Experiments with the partially deuterated 1,3-butadienes indicate that the atomic hydrogen loss originates from one of the terminal carbon atoms of 1,3-butadiene. A combination of the experimental data with electronic structure calculations suggests that the thermodynamically less favorable 1-cyano-1,3-butadiene isomer represents the dominant reaction product; possible minor contributions of less than a few percent from the aromatic pyridine molecule might be feasible. Low-temperature kinetics studies demonstrate that the overall reaction is very fast from room temperature down to 23 K with rate coefficients close to the gas kinetic limit. This finding, combined with theoretical calculations, indicates that the reaction proceeds on an entrance barrier-less potential energy surface (PES). This combined experimental and theoretical approach represents an important step toward a systematic understanding of the formation of complex, nitrogen-bearing molecules-here on the C 5 H 6 N PES-in low-temperature extraterrestrial environments. These results are compared to the reaction dynamics of D1-ethynyl radicals (C 2 D; X 2 Σ +) with 1,3-butadiene accessing the isoelectronic C 6 H 7 surface as tackled earlier in our laboratories.

Fusarium pseudograminearum (O'Donnell & Aoki), a residue-borne pathogen, is responsible for crown rot of wheat (Triticum aestivum L.). Since its first detection in Queensland, Australia in 1951, it has been reported in many other countries, but not China (2). In May 2011, a crown rot disease was observed in wheat cv. Aikang 58 in a wheat-maize rotation, irrigable and loam field in Henan Province, China. Diseased wheat plants showed honey brown discoloration in the stem bases and whitehead in some plants, which are symptoms of crown rot with about 70% incidence in a surveyed field (2). The pathogen was isolated from diseased stem base on potato dextrose agar (PDA) after being surface-disinfested with 5% NaClO solution for 2 min. Pure cultures were established on carnation leaf agar (CLA) through a single spore technique and identified by morphological and molecular methods according to protocols described previously (1,3,4). Macroconidia of F. pseudograminearum were formed in abundant sporodochia on CLA cultures grown under the BLB light. Macroconidia were usually five septate (about three to seven) and 27 to 91 × 2.7 to 5.5 μm. Colonies grown on PDA from a single conidium in the dark at 25°C had average radial growth rates of ~4.7 to 9.9 mm per day. Colony pigment on PDA grown under light varied from rose to burgundy, while mycelium ranged from rose to yellow white. Two isolates (WZ-8A and WZ-2B) were selected for molecular identification. The translation elongation factor 1-α gene and rDNA ITS gene were amplified by PCR using the specific primers described previously (4). PCR products were sequenced (GenBank Accession Nos. JN862232 to JN862235). Phylogenic analysis of the sequence indicated that the isolates were identified as F. pseudograminearum. The identification was further confirmed by the F. pseudograminearum species-specific PCR primers (Fp1-1: CGGGGTAGTTTCACATTTCCG and Fp1-2: GAGAATGTGATGACGACAATA) (1). The expected PCR products of 520 bp were produced only in F. pseudograminearum. Isolates WZ-2B and WZ-8A were deposited in the Agriculture Culture Collection of China as ACCC38067 and ACCC 38068, respectively. Pathogenicity tests were conducted by inoculating winter wheat cultivar Wenmai 19 with isolates WZ-8A and WZ-2B through soil inoculation. Inoculum was prepared by growing cultures on sterilized wheat bran and chopped wheat-straw (4:1, v/v) after incubation at 25°C for 2 weeks. This inoculum was added to sterilized soil at 1% by volume and no inoculum was added in control treatment. Five seeds were planted in a 15 cm wide pot in a 20 to 25°C greenhouse, with six replications. Seedling death and crown browning occurred in the inoculated wheat plants after 4 weeks with over 90% incidence, while no symptoms developed in the control plants. The fungus was reisolated from inoculated plants, fulfilling Koch's postulates. To our knowledge, this is the first report of F. pseudograminearum causing crown rot of wheat in China. Considering Henan is the largest wheat production province in China with over 5 million hectares planting area, and the soil and climate conditions are suitable for this disease, it will be a important pathogen of wheat in Henan in the future. References: (1) T. Aoki et al. Mycologia 91:597, 1999. (2) L. W. Burgess. Page 271 in: Crown Rot of Wheat: Fusarium. B. A. Summerell et al., eds. APS Press, St. Paul, MN, 2001. (3) R. G. Francis et al. Trans. Brit. Mycol. Soc. 68:421, 1977. (4) J. B. Scott et al. Mycol. Res. 110:1413, 2006.

Summary To investigate the distribution and diversity of the pathogens associated with Fusarium crown rot in the Huanghuai wheat‐growing region (HHWGR) of China, we collected wheat samples with symptomatic stem bases from seven provinces in the HHWGR between 2013 and 2016. A total of 1196 isolates obtained from 222 locations were identified as 9 Fusarium species based on morphological and molecular identification. Of these pathogen species, F. pseudograminearum was the dominant species. Furthermore, F. sinensis was isolated from the disease specimens and tested for virulence to wheat. The result of the pathogenicity revealed that an intraspecific differentiation existed in F. pseudograminearum; sequence analysis of the EF‐1α gene showed that 194 F. pseudograminearum isolates were differentiated into two distinct clades which closed to the strains from Australia and China respectively, but neither pathogenicity nor EF‐1α sequence was related to the geographic origins of these isolates. However, universal rice primers‐polymerase chain reaction showed a correlation with the geographical origins of the 194 isolates, which were divided into eight subclusters, the level of genetic diversity was higher within a geographical population than among the different populations. The results of these analyses can be directly used to facilitate disease monitoring and development of control strategies.

As one of the simplest molecules containing a peptide bond, N-methyl formamide (HCONHCH 3) represents a potential key molecule involved in the peptide bond polymerization in extraterrestrial ices. Detected tentatively toward the star-forming region Sgr B2(N2), the synthetic pathways have previously been elusive. By exploiting isomer-selective detection of the reaction products via photoionization, coupled with reflectron time-of-flight mass spectrometry (PI-ReTOF-MS), we present compelling evidence for the formation of N-methyl formamide (HCONHCH 3) in astrochemically relevant ice mixtures of methylamine (CH 3 NH 2) and carbon monoxide (CO), upon irradiation with energetic electrons as generated in the track of galactic cosmic ray particles (GCRs) penetrating interstellar ices. As one of the simplest molecules containing a peptide bond (-CO-NH-), N-methyl formamide could represent a benchmark involved in radiation-induced peptide bond polymerization in extraterrestrial ices, and thus bring us closer to revealing where in the Universe the molecular precursors linked to the origins of life might have been synthesized.