Although polyomavirus JC (JCV) is the proven pathogen of progressive multifocal leukoencephalopathy, the fatal demyelinating disease, this virus is ubiquitous as a usually harmless symbiote among human beings. JCV propagates in the adult kidney and excretes its progeny in urine, from which JCV DNA can readily be recovered. The main mode of transmission of JCV is from parents to children through long cohabitation. In this study, we collected a substantial number of urine samples from native inhabitants of 34 countries in Europe, Africa, and Asia. A 610-bp segment of JCV DNA was amplified from each urine sample, and its DNA sequence was determined. A worldwide phylogenetic tree subsequently constructed revealed the presence of nine subtypes including minor ones. Five subtypes (EU, Af2, B1, SC, and CY) occupied rather large territories that overlapped with each other at their boundaries. The entire Europe, northern Africa, and western Asia were the domain of EU, whereas the domain of Af2 included nearly all of Africa and southwestern Asia all the way to the northeastern edge of India. Partially overlapping domains in Asia were occupied by subtypes B1, SC, and CY. Of particular interest was the recovery of JCV subtypes in a pocket or pockets that were separated by great geographic distances from the main domains of those subtypes. Certain of these pockets can readily be explained by recent migrations of human populations carrying these subtypes. Overall, it appears that JCV genotyping promises to reveal previously unknown human migration routes: ancient as well as recent.

No abstract

BACKGROUND The translocation t(12;21)(p13;q22), which produces the TEL/AML1 fusion gene, is the most frequent chromosomal abnormality in patients with childhood acute lymphoblastic leukemia (ALL) and generally is associated with a favorable prognosis. Furthermore, real‐time quantitative‐polymerase chain reaction (RQ‐PCR)‐based detection of TEL/AML1 represents an accurate technique for the reproducible assessment of minimal residual disease (MRD). METHODS The authors employed RQ‐reverse transcriptase‐PCR (RQ‐RT‐PCR) technology to analyze MRD levels in 57 newly diagnosed patients with TEL/AML1 positive ALL in a prospective study. RESULTS On Day + 33, a particularly important time point in terms of outcome prediction based on MRD monitoring, 75% of patients reached negativity, 13% of patients were positive at very low levels (< 10−4; i.e., 1 or more leukemic cell per 104 normal cells), and another 13% of patients were positive at the level of 10−2 to 10−4 cells. No patient showed MRD levels ≥ 10−2 cells at this time. The data demonstrate that patients with TEL/AML1 positive ALL had a better response to induction chemotherapy on Day + 33 compared with a group of unselected patients with ALL (P = 0.0001). However, four patients with TEL/AML1 positive ALL developed relapse disease. Remarkably, these children were positive for MRD on Day + 33 at a level between 10−2 cells and 10−4 (n = 3 patients) and at < 10−4 (n = 1 patient). Kaplan–Meier analysis of disease free survival showed the statistical significance of this distribution (MRD positive vs. MRD negative; log‐rank P = 0.0016). CONCLUSIONS The authors conclude that, although the TEL/AML1 positive leukemias generally are associated with a favorable outcome, MRD positivity assessed by RQ‐RT‐PCR analysis at the end of induction therapy represents a significantly negative prognostic feature. Cancer 2003;97:105–13. © 2003 American Cancer Society. DOI 10.1002/cncr.11043

(Fig. 1). PMPApp is a competitive inhibitor (with respect to dATP) and a substrate of HIV type 1 (HIV-1) reverse transcriptase (RT) (9, 30). Diphosphates of several ANPs have been identified as good substrates as well as potent inhibitors of cellular replicative DNA polymerases (pol) in vitro (5, 6,(19)(20)(21). This activity correlates well with the cytostatic effects of their parental compounds (1, 2,14,25,31), suggesting that the interaction of phosphorylated analogs with cellular DNA synthesis may significantly contribute to their cellular toxicity. 2 In this study, we examined the substrate affinity and inhibitory efficiency of PMPApp with respect to rat pol ␣, ␦, and ε*. PMPApp was synthesized from PMPA (16) by the standard procedure (17). The enzymes were isolated from SpragueDawley rat compact transplantable lymphomas by previously described procedures (7, 22) but omitting glycerol gradient centrifugation. The human recombinant proliferating cell nuclear antigen was purified from BL21(DE3) cells by using a published protocol (15). Enzyme activities on the templateprimer DNA 40/18 (5Ј-GAGATCTCCTAGGGGCCC, 3Ј-CTC TAGAGGATCCCCGGGTACCGAGCTCGAATTCGTAAT C-5Ј; molar ratio, 1:1.5) were measured under the following reaction conditions: (i) for pol ␣, 40 mM HEPES-KOH (pH 7.0), 25 mM KCl, and 10 mM MgCl 2 ; (ii) for pol ␦, 40 mM HEPES-KOH (pH 7.0), 50 mM KCl, 10 mM MgCl 2 , and proliferating cell nuclear antigen (18 g ml Ϫ1 ); and (iii) for pol ε*, 40 mM HEPES-KOH (pH 7.5), 100 mM KCl, and 10 mM MgCl 2 . All reaction mixtures also contained 1 mM dithiothreitol, 200 g of BSA ml Ϫ1 , and 10% glycerol. The experiments using poly(dT)-oligo(dA) 12-18 as a template primer were conducted as previously published (21). One unit of DNA pol activity is defined as the amount of enzyme that catalyzes the incorporation of 1 nmol of dATP into the template primer poly(dT)-oligo(dA) 12-18 after 30 min of incubation under previously described reaction conditions (21). Efficiencies of PMPApp and dATP incorporation catalyzed by examined DNA pol were compared by measurement of kinetic constants (dATP V max ) using the template-primer DNA 40/18 with 0.5 M 32 P-labeled primer. The experiments using the reaction mixture (25 l) were carried out at 37°C in the presence of eight different concentrations of either dATP or PMPApp by using the reaction conditions described above. After incubation over four different time intervals, the products were processed as described previously (6) and separated by polyacrylamide gel electrophoresis. The amounts of extended and unextended primer were assessed by using a PhosphoImager (Molecular Dynamics, Sunnyvale, Calif.). Kinetic experiments to determine PMPApp K i and dATP K m values for the enzymes on the poly(dT)-oligo(dA) 12-18 template-primer were performed as outlined previously by Kramata et al. (21).Our results show a very poor capability of all three enzymes for incorporation of the analog into DNA (Fig. 2 and 3); the incorporation efficiency (f ins ) (8)

No abstract

The study investigated possible mechanisms by which second-generation taxanes, established as significantly more effective than paclitaxel in vitro, suppress a rat lymphoma model in vivo. The studied mechanisms included taxane pharmacokinetics, expression of genes dominating their metabolism (Cyp3a1/2) and transport (Abcb1) and genes controlling tumour angiogenesis (growth factors and receptors). SB-T-1214, SB-T-12854 and IDN5109 suppressed rat lymphoma more effectively than paclitaxel, SB-T-12851, SB-T-12852, SB-T-12853 or IDN5390 as well as P388D1 leukaemia cells in vitro. The greater anti-lymphoma effects of SB-T-1214 in rats corresponded to a higher bioavailability than with SB-T-12854, and lower systemic toxicity of SB-T-1214 for rats reflected its lower cytotoxicity for P388D1 cells in vitro. Suppression of Abcb1 and CYP3a1 expression by SB-T-1214 and IDN5109 could partly explain their anti-lymphoma effects, but not that of SB-T-12854. Growth factors genes Egf, Fgf, Pdgf, and Vegf associated with tumour angiogenesis had significantly lower expression following treatment with anti-lymphoma effective IDN5109 and their receptors were unaffected, whereas inefficient IDN5390 increased expression of the most important Vegf. The effective SB-T-12854 inhibited Egf, Egfr, Fgfr and Pdgfr expression, while the ineffective SB-T-12851, SB-T-12852 and SB-T-12853 inhibited only Egf or Egfr expression. Vegfr expression was inhibited significantly by SB-T-12851 and SB-T-12854, but effect of SB-T-12851 was compromised by induced Vegf expression. The very effective SB-T-1214 decreased the expression of Vegf, Egf and all receptors most prominently indicating the possible supporting role of these genes in anti-lymphoma effects. In conclusion, SB-T-1214, SB-T-12854 and IDN5109 are good candidates for further study.

No abstract

No abstract