Biological tissues must generate forces to shape organs and achieve proper development. Such forces often result from the contraction of an apical acto-myosin meshwork. Here we describe an alternative mechanism for tissue contraction, based on individual cell volume change. We show that during Drosophila dorsal closure (DC), a wound healing-related process, the contraction of the amnioserosa (AS) is associated with a major reduction of the volume of its cells, triggered by caspase activation at the onset of the apoptotic program of AS cells. Cell volume decrease results in a contractile force that promotes tissue shrinkage. Estimating mechanical tensions with laser dissection and using 3D biophysical modeling, we show that the cell volume decrease acts together with the contraction of the actin cable surrounding the tissue to govern DC kinetics. Our study identifies a mechanism by which tissues generate forces and movements by modulating individual cell volume during development.

Summary During development, cell-generated forces induce tissue-scale deformations to shape the organism [ 1 , 2 ]. The pattern and extent of these deformations depend not solely on the temporal and spatial profile of the generated force fields but also on the mechanical properties of the tissues that the forces act on. It is thus conceivable that, much like the cell-generated forces, the mechanical properties of tissues are modulated during development in order to drive morphogenesis toward specific developmental endpoints. Although many approaches have recently emerged to assess effective mechanical parameters of tissues [ 3 , 4 , 5 , 6 , 7 , 8 ], they could not quantitatively relate spatially localized force induction to tissue-scale deformations in vivo . Here, we present a method that overcomes this limitation. Our approach is based on the application of controlled forces on a single microparticle embedded in an individual cell of an embryo. Combining measurements of bead displacement with the analysis of induced deformation fields in a continuum mechanics framework, we quantify material properties of the tissue and follow their changes over time. In particular, we uncover a rapid change in tissue response occurring during Drosophila cellularization, resulting from a softening of the blastoderm and an increase of external friction. We find that the microtubule cytoskeleton is a major contributor to epithelial mechanics at this stage. We identify developmentally controlled modulations in perivitelline spacing that can account for the changes in friction. Overall, our method allows for the measurement of key mechanical parameters governing tissue-scale deformations and flows occurring during morphogenesis.

SummaryDuring epithelial contraction, cells generate forces to constrict their surface and, concurrently, fine-tune the length of their adherens junctions to ensure force transmission. While many studies have focused on understanding force generation, little is known on how junctional length is controlled. Here, we show that, during amnioserosa contraction in Drosophila dorsal closure, adherens junctions reduce their length in coordination with the shrinkage of apical cell area, maintaining a nearly constant junctional straightness. We reveal that junctional straightness and integrity depend on the endocytic machinery and on the mechanosensitive activity of the actomyosin cytoskeleton. On one hand, upon junctional stretch and decrease in E-cadherin density, actomyosin relocalizes from the medial area to the junctions, thus maintaining junctional integrity. On the other hand, when junctions have excess material and ruffles, junction removal is enhanced, and high junctional straightness and tension are restored. These two mechanisms control junctional length and integrity during morphogenesis.

SUMMARYAn appropriate organisation of muscles is crucial for their function, yet it is not known how functionally related muscles are coordinated with each other during development. In this study, we show that the development of a subset of functionally related head muscles in the zebrafish is regulated by Ret tyrosine kinase signalling. Three genes in the Ret pathway (gfra3, artemin2 and ret) are required specifically for the development of muscles attaching to the opercular bone (gill cover), but not other adjacent muscles. In animals lacking Ret or Gfra3 function, myogenic gene expression is reduced in forming opercular muscles, but not in non-opercular muscles derived from the same muscle anlagen. These animals have a normal skeleton with small or missing opercular muscles and tightly closed mouths. Myogenic defects correlate with a highly restricted expression of artn2, gfra3 and ret in mesenchymal cells in and around the forming opercular muscles. ret + cells become restricted to the forming opercular muscles and a loss of Ret signalling results in reductions of only these, but not adjacent, muscles, revealing a specific role of Ret in a subset of head muscles. We propose that Ret signalling regulates myogenesis in head muscles in a modular manner and that this is achieved by restricting Ret function to a subset of muscle precursors. KEY WORDS: Zebrafish, GDNF, Head muscle, MusculoskeletalRet signalling integrates a craniofacial muscle module during development specifically regulate myogenesis in muscles attaching to the opercular bone. Specific activation of Ret signalling is achieved through the restricted expression of both ret (ret1 -Zebrafish Information Network), gfra3 and an activating ligand, artemin2 (artn2), in cells associated with opercular muscles. The specificity of the muscle phenotype in Ret signalling mutants reveals an unexpected modularity of head muscle development that does not correspond to the origin of the muscles from a particular pharyngeal arch, but instead reflects the subsequent function of the muscles. MATERIALS AND METHODSAll protocols used were as described previously (Nusslein-Volhard and Dahm, 2002;Westerfield, 2007) except those described below. Generation and identification of mutantsThe stumm (stm) mutant (allele hy024) was identified in a large-scale Nethyl-N-nitrosourea (ENU) mutagenesis screen (Tübingen 2000 Screen Consortium). stm hy024 was mapped to linkage group 14 by bulk segregation analysis and fine mapped using 1000 embryos to a 0.2 cM interval between z1812 and z28688. Mapping was confirmed with a single-nucleotide polymorphism (SNP; 1204a) to position the locus 0.2cM towards the centrosome from z1812 at 38.1 (MGH mapping panel); the map position of gfra3 was confirmed on the T51 radiation hybrid panel. stm hy024 mutants and wild-type (WT) siblings were identified by sequencing a 532 bp region of exon 4 from gfra3 amplified with primers gfra3-1 (GTACCGGG -TTGGCTTAGATTC) and gfra3-2 (GTAGGAACAGGAGGGCACAA). The ret mutant (ret hu2846 ) was identified by TILLIN...

Epithelial spreading is a fundamental mode of tissue rearrangement occurring during animal development and wound closure. It has been associated either with the collective migration of cells [1, 2] or with actomyosin-generated forces acting at the leading edge (LE) and pulling the epithelial tissue [3, 4]. During the process of Drosophila head involution (HI), the epidermis spreads anteriorly to envelope the head tissues and fully cover the embryo [5]. This results in epidermal segments of equal width that will give rise to the different organs of the fly [6]. Here we perform a quantitative analysis of tissue spreading during HI. Combining high-resolution live microscopy with laser microsurgery and genetic perturbations, we show that epidermal movement is in part, but not solely, driven by a contractile actomyosin cable at the LE. Additional driving forces are generated within each segment by a gradient of actomyosin-based circumferential tension. Interfering with Hedgehog (Hh) signaling can modulate this gradient, thus suggesting the involvement of polarity genes in the regulation of HI. In particular, we show that disruption of these contractile forces alters segment widths and leads to a mispositioning of segments. Within the framework of a physical description, we confirm that given the geometry of the embryo, a patterned profile of active circumferential tensions can indeed generate propelling forces and control final segment position. Our study thus unravels a mechanism by which patterned tensile forces can regulate spreading and positioning of epithelial tissues.

No abstract

15During development, cell-generated forces induce tissue-scale deformations to 16 shape the organism. Here, we present a method that allows to quantitatively 17 to actomyosin, the microtubule cytoskeleton is a major contributor to epithelial 27 mechanics at that stage. Overall, our method allows for measuring essential 28

Cells generate mechanical forces to shape tissues during morphogenesis. These forces can activate several biochemical pathways and trigger diverse cellular responses by mechano-sensation, such as differentiation, division, migration and apoptosis. Assessing the mechano-responses of cells in living organisms requires tools to apply controlled local forces within biological tissues. For this, we have set up a method to generate controlled forces on a magnetic particle embedded within a chosen tissue of Drosophila embryos. We designed a protocol to inject an individual particle in early embryos and to position it, using a permanent magnet, within the tissue of our choice. Controlled forces in the range of pico to nanonewtons can be applied on the particle with the use of an electromagnet that has been previously calibrated. The bead displacement and the epithelial deformation upon force application can be followed with live imaging and further analyzed using simple analysis tools. This method has been successfully used to identify changes in mechanics in the blastoderm before gastrulation. This protocol provides the details, (i) for injecting a magnetic particle in Drosophila embryos, (ii) for calibrating an electromagnet and (iii) to apply controlled forces in living tissues.