Plants were grown in the greenhouse or in the field under standard conditions. We used the B73 wild-type line. For cytokinin induction experiments, 2-week-old seedlings were excised at the shoot-root junction, and stood in water supplemented with different concentrations of cytokinin. After treatments, the seedlings were dissected into a shoot fraction (apical and axillary shoot meristems, stem and 4-5 young leaf primordia) or a leaf fraction (expanding and mature leaves). For embryo culture experiments, pollinated ears at either 13 days after pollination (first leaf stage) or 16 days after pollination (second to third leaf stage) were sterilized in 30% commercial bleach solution for 20 min then rinsed five times with sterile water. The embryos were dissected out and cultured on maize embryo culture medium (1 £ Murashige and Skoog salts, 1 £ Gamborg's vitamins, 2% sucrose, 0.7% agar, pH 5.7) in some cases with the addition of cytokinin (kinetin, 10 25 , 10 26 or 10 27 M). The embryos were cultured at 28 8C in the dark for 5-7 days then fixed and cleared and the shoot meristems were measured as described 5. Molecular biology Standard protocols were used for maize DNA isolation and Southern blotting 30. For RT-PCR analysis, poly(A þ) RNA was isolated using an Oligotex messenger RNA mini kit (Qiagen) according to the manufacturer's protocol. The primers ZmRR3f (GATGGCGAGCCGCAAGTGT) and ZmRR3r (AATGCCGCTGCTACAGCTACCA) were used to amplify ABPH1 transcripts using the one step RT-PCR kit (Qiagen). The control primers Ubi 5 0 (TAAGCTGCCGATGTGCCTGCGTCG) and Ubi 3 0 (CTGAAAGACAGAACATAATGAGCACAG) were used to amplify control ubiquitin transcripts. PCR conditions were 94 8C, 15 s, 62 8C, 15 s, 72 8C, 45 s, with a 1 8C reduction in annealing temperature per cycle, touching down at 56 8C annealing, followed by 15 additional cycles. The PCR cycle number was limited to ensure semi-quantitative amplification, and no PCR product was visible on the ethidium-bromide-stained agarose gels. The gels were Southern blotted and probed with an ABPH1 or UBIQUITIN probe. ABPH1 transcript levels were estimated using a phosphoimager (Fuji) and were normalized against the respective ubiquitin values. In situ hybridizations were performed as described 5 .

The pentatricopeptide repeat (PPR) family represents one of the largest gene families in plants, with >440 members annotated in Arabidopsis thaliana. PPR proteins are thought to have a major role in the regulation of posttranscriptional processes in organelles. Recent studies have shown that Arabidopsis PPR proteins play an essential, nonredundant role during embryogenesis. Here, we demonstrate that mutations in empty pericarp4 (emp4), a maize (Zea mays) PPR-encoding gene, confer a seed-lethal phenotype. Mutant endosperms are severely impaired, with highly irregular differentiation of transfer cells in the nutrient-importing basal endosperm. Analysis of homozygous mutant plants generated from embryo-rescue experiments indicated that emp4 also affects general plant growth. The emp4-1 mutation was identified in an active Mutator (Mu) population, and cosegregation analysis revealed that it arose from a Mu3 element insertion. Evidence of emp4 molecular cloning was provided by the isolation of four additional emp4 alleles obtained by a reverse genetics approach. emp4 encodes a novel type of PPR protein of 614 amino acids. EMP4 contains nine 35-amino acid PPR motifs and an N-terminal mitochondrion-targeted sequence peptide, which was confirmed by a translational EMP4-green fluorescent protein fusion that localized to mitochondria. Molecular analyses further suggest that EMP4 is necessary to regulate the correct expression of a small subset of mitochondrial transcripts in the endosperm.

SummaryOrthopoxviruses (OPVs) have recently received increasing attention because of their potential use in bioterrorism and the occurrence of zoonotic OPV outbreaks, highlighting the need for the development of safe and cost-effective vaccines against smallpox and related viruses. In this respect, the production of subunit protein-based vaccines in transgenic plants is an attractive approach. For this purpose, the A27L immunogenic protein of vaccinia virus was expressed in tobacco using stable transformation of the nuclear or plastid genome. The vaccinia virus protein was expressed in the stroma of transplastomic plants in soluble form and accumulated to about 18% of total soluble protein (equivalent to approximately 1.7 mg/g fresh weight). This level of A27L accumulation was 500-fold higher than that in nuclear transformed plants, and did not decline during leaf development.Transplastomic plants showed a partial reduction in growth and were chlorotic, but reached maturity and set fertile seeds. Analysis by immunofluorescence microscopy indicated altered chlorophyll distribution. Chloroplast-synthesized A27L formed oligomers, suggesting correct folding and quaternary structure, and was recognized by serum from a patient recently infected by a zoonotic OPV. Taken together, these results demonstrate that chloroplasts are an attractive production vehicle for the expression of OPV subunit vaccines.

In maize vivipary, the precocious germination of the seed while still attached to the ear, is the diagnostic phenotype of mutants, which are impaired in the biosynthesis or response to abscisic acid (ABA). Of the 15 genes so far described, 12 control specific steps in ABA biosynthesis, two mediate hormone response and one still has an undefined role. We have analyzed a collection of 25 independent vp isolates with the aim of determining the degree of mutational saturation that has so far been reached. Of the 25 viviparous mutants complementation tested, 22 correspond to known loci: six are allelic to vp1, another six to vp5, one to vp7, two to vp9, six to vp10 and one to w3. The remaining three represent genes not previously identified. All mutants so far tested except rea show a decrease in ABA content. As to the only two mutants (vp1 and rea) whose endogenous ABA content is not impaired, the reduction in sensitivity of the double mutant compared to the single ones suggests that the two genes control separate pathways in the ABA signal transduction. Some of the mutants in this collection have a characteristic incomplete germination that allows the embryo of the mature dry seed to resume germination. By exploiting this feature it is possible to infer, through a germination test, whether the mutant has been impaired in the acquisition of desiccation tolerance. This information provides the starting point for the dissection of the genetic basis of desiccation tolerance.

The maize seed comprises two major compartments, the embryo and the endosperm, both originating from the double fertilization event. The embryogenetic process allows the formation of a well-differentiated embryonic axis, surrounded by a single massive cotyledon, the scutellum. The mature endosperm constitutes the bulk of the seed and comprises specific regions containing reserve proteins, complex carbohydrates, and oils. To gain more insight into molecular events that underlie seed development, three monogenic mutants were characterized, referred to as emp (empty pericarp) on the basis of their extreme endosperm reduction, first recognizable at about 12 d after pollination. Their histological analysis reveals a partial development of the endosperm domains as well as loss of adhesion between pedicel tissues and the basal transfer layer. In the endosperm, programmed cell death (PCD) is delayed. The embryo appears retarded in its growth, but not impaired in its morphogenesis. The mutants can be rescued by culturing immature embryos, even though the seedlings appear retarded in their growth. The analysis of seeds with discordant embryo-endosperm phenotype (mutant embryo, normal endosperm and vice-versa), obtained using B-A translocations, suggests that emp expression in the embryo is necessary, but not sufficient, for proper seed development. In all three mutants the picture emerging is one of a general delay in processes related to growth, as a result of a mutation affecting endosperm development as a primary event.