General equations are derived for the limit yield [PZ] infinity of the intraduplex reaction between reactive oligonucleotide derivative X bearing p-(N-2-chloroethyl-N-methyl-amino)phenyl residue and oligonucleotide target P encompassing the sequence complementary to X in the presence of one or two oligonucleotide effectors E1 and E2. The latters form the complementary tandem sequence E1-X-E2 at the target. It is shown that association constants characterizing the affinity of the reagent X to the effector containing complexes PE1, PE2 and PE1E2 may be calculated from the dependencies of [PZ] infinity on the initial concentration chi 0 of X providing the sufficient excess of effectors is present. The approach was applied to reaction of C1RCH2NHpd(TTCCCA) with 26-mer dTTGCCTTGAATGGGAAGAGGGTCATT and effectors Phn-L-pd(TTCAAGG-C)p-L-Phn(E1) and Phn-L-pd(TGACCCTC)p-L-Phn(E2) where Phn- is N-(2-hydroxyethyl)-phenazinium residue and L is -NHCH2CH2NH- spacer. The association constants were found to be Kxe1 = 6.75 x 10(5)M-1, Kxe2 = 4.15 x 10(4)M-1 and Kxe12 = 5.87 x 10(6)M-1 as compared with the affinity of X to P Kx = 2.16 x 10(4)M-1 in the absence of effectors. The experiments on self-alkylation of target reactive derivative C1RCH2NHpd(TTGCCTTGAATGGGAAGAGGGTCATT) both in the presence and in the absence of effector E2 as well as the Molecular Mechanics calculations of its prereactive states showed target to form the hairpin secondary structure. Under reasonable suggestions taking into account the internal structure of the target co-operativity parameters describing the contribution of interactions of the terminal nucleotides of X with adjacent residues of effector were calculated and found to be alpha 1 = 16, alpha 2 = 10 and alpha 12 = 139 for the duplexes PXE1, PXE2 and PXE1E2, respectively.
Parameters of cooperative interactions of two or three oligodeoxyribonucleotides or their derivatives bound with the adjacent sites of the complementary template were measured using method of "complementary addressed modification titration" (CAMT). Complementary template (target) were modified with the reactive oligonucleotide derivatives (reagents) bearing covalently attached alkylating 4-[N-(2-chloroethyl)-N-methylamino]benzylamino- group (C1RCH2NH)- at 5'-terminal phosphate. The targets had only one binding site for the reagent and either no (T10), or one (T'22 and T22) or two sites (T26) for the oligonucleotides (effectors) cooperatively bound with the adjacent sites on the template. Both unmodified oligonucleotides E1, E2 and their derivatives E1Phn, E2Phn bearing N-(2-hydroxyethyl)-phenazinium residues Phn- both at 5'- and 3'-ends covalently linked via ethylenediamine linker were used as effectors. Effectors E1 and E2 (E1Phn and E2Phn) bind, respectively, upstream or downstream from the reagent. Hexameric (X6) or octameric (X8 or X8m) reagents were used for the target modification. The reagent X8m formed one TT-mismatch with the target at the end opposite to location of the reactive moiety. The cooperativity parameter values characterizing the mutual interactions between the reagents X6, X8, X8m and effectors E1, E2, E1Phn, E2Phn have been found as the ratio of the association constants of the reagents in the presence of effectors. The association constants were calculated from the dependencies of the target modification extent on initial concentrations of the reagents. The use of T26 existing both in linear and hairpin conformations permitted us to estimate additionally the role of indirect cooperativity originating from the induction of the target conformational change by the effectors. The following conclusions were done from the quantitative results. The efficiency of direct cooperativity is independent on the length of oligonucleotide for the same nature of the contact. The cooperativity parameter increases by factor about 3 in the presence of Phn-group covalently attached to oligonucleotides and located at the junctions. The presence of either alkylating group C1RCH2NH- or TT-mismatch at the junctions eliminates cooperative interaction between the bases. In the same time sufficiently effective cooperative interaction takes place in the case of simultaneous presence of both Phn- and either C1RCH2NH- group or TT-mismatch at the junction.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.