ObjectivesHeart involvement in multisystem inflammatory syndrome associated with COVID-19 in children (MIS-C) is a new challenging problem, requiring fast and reliable diagnostics and appropriate treatment. The aim of this study is to describe heart involvement in patients with MIS-C.Study DesignIn this retrospective, multicenter cohort study, data of 122 patients were included. All patients met WHO and CDC criteria of MIS-C.ResultsVarious types of heart involvement in MIS-C patients were observed. Patients with solely coronary artery lesions (CAL, n = 10, 8.2%) had typical features of Kawasaki disease: younger age, thrombocytosis and normal ferritin level, without giant CA aneurysms, thrombosis, myocardial infarction, shock, and ICU admission. Patients with solely myocardial involvement (MI, n = 30, 24.6%) had an older onset age, elevated ferritin, LDH, the highest D-dimer, H score, and thrombocytopenia level. The following clinical signs were associated with MI: gastrointestinal and central nervous system disorder, sore throat, swelling face, splenomegaly, shock, and treatment in the intensive care unit required. Patients with a combination of CAL and MI (n = 10, 8.2%) had symptoms similar to patients with solely MI, except for impressive thrombocytopenia. Shock and ICU admission were found in 34.7% of patients without heart involvement (n = 72, 59%). One major criterion [troponin > 32 pg/ml (52 points)] or at least two minor criteria [face swelling (32 points) and D-Dimer > 1,300 ng/ml (29 points)] were associated with MI (>32 points) with a sensitivity of 67.5% and a specificity of 88.9%.ConclusionThe above-suggested criteria can be added to routine diagnostic procedures to confirm MI in MIS-C patients.
3600 mg/dl; IgM 126 mg/dl), elevated serum amyloid A levels (160 mg/ml) and decreased CD4/CD8 T cell ratio. Autoantibody (ANA, ENA, anti-DNA) and HLA B 27 were negative. WES analysis showed the de novo heterozygous missense variation c.C1132A (p.H378N) in PIM-1 gene (NM_001243186). This variation was never described in on-line database (HGMD, Exac, 1000 g, ESP6500). The second patient was an adult female with a clinical history of persistent microcytic anemia, splenomegaly, striking hypergammaglobulinemia (IgG > 3000 mg/dL) and recurrent protracted fever episodes during childhood. At 13 years, she underwent splenectomy because of hypersplenism. At 28 years she presented a cerebral oligoastrocytoma that was removed by surgery. No mutations were found in genes associated with autoimmune lymphoproliferative syndromes and histiocytosis (FAS, FASLG, XIAP, TNFRSF13B, UNC13D, CASP9, CASP10). The direct sequencing of PIM-1 revealed again the above described de novo mutation in PIM-1. Conclusion:We propose that these patients represent two cases of a novel syndrome associated with a specific mutation in PIM-1 gene (PLAS). First, the two cases share significant overlap of autoinflammatory and proliferative features involving the endothelial and the immune systems. Second, the gene mutation identified was never described in healthy people or in patients with other disorders and is predicted to be pathogenic based on all the bionformatic tools. Finally, previous functional studies showed that PIM-1 pathway is relevant to immune activation and indeed somatic mutations in this gene have been reported in association with lymphomas, and it is thought to contribute to survival of cancerous cells. Disclosure of Interest None Declared O6Biallelic hypomorphic mutations in a linear deubiquitinase define otulipenia, an early-onset systemic autoinflammatory disease
Background/Purpose The CCR5 protein is a chemokine receptor, and is known to be expressed on T cells, macrophages, dendritic and microglia cells. It is believed that different prevalence of HLA and CCR5-delta32-a 32 base pair deletion in the coding region-in various ethnic groups is associated with the severity and prevalence of chemokine-mediated autoimmune diseases, systemic-onset Juvenile Idiopathic Arthritis (soJIA) being among them (Del Rincon et al., 2003). Since the end of the last century the protective role of the CCR5-delta32 mutation against JIA is discussed (Hinks et al., 2010), though it seems the role of this mutation is less simple than was hitherto thought. The purposes of the study was to compare the prevalence of the CCR5-delta32 mutation in children with and without soJIA, to assess the association of this mutation with the severity of the disease and thus to evaluate its protective role. Methods 234 children (193 of European origin, 25-Hispanic or Latino, 14-Afro-Americans, 3-of Asian origin) with soJIA living in the USA and in the Northwestern part of Russia were enrolled in the study. Genomic DNA was isolated from blood samples using QIAamp Mini Kit and amplified by PCR. The following oligonucleotide primers were used to detect CCR5 d32: CCR5-Δ32-F: 5′CTTCATTACACCTGCAGTC3′, CCR5-Δ32-R: 5′TGAAGATAAGCCTCACAGCC3′ by following condition: 95°-5′×1; 95°-15"355°-15"372°-60"×40; 72°-10′×13 4°-∞; the resulting PCR products were separated on 2% agarose gel by electrophoresis and visualized by Gel Doc XR Plus.
Background:JIA is the most common chronic condition in pediatric rheumatology. The cervical spine (CS) involvement is associated with severe disease activity and disability and has been recognized as a factor of a poor prognosis. Data about the CS involvement is contradictory due to silent CS involvement in some patients.Objectives:the aim of our study was to provide a clinical profile of the patients with the CS involvement.Methods:753 patients for last 10 years with JIA were analyzed. Patients were divided depending on the CS involvement, which was confirmed by clinical (pain, LOM) and radiological features (effusion in the CS joints). We evaluated active joints and routine tests, such as CRP, ESR, ANA-positivity and HLA B27Results:The CS involvement was in 101 patients (13.4%). The data are in the table. The CS involvement was more frequently associated with joints of upper body, such as TMJ (23.7% vs 2.9%, p=0.000001), shoulder (29.7% vs 2.9%, p=0.000001), elbow (34.2% vs 12.2%, p=0.000001), wrist (61.4% vs 21.8%, p=0.0000001), MCP (43.6% vs 18.4%, p=0.0000001), PIP (52.5% vs 21.3%, p=0.0000001), DIP (23.8% vs 7.1%, p=0.0000001) and hip (44.6% vs 16.6%, p=0.0000001), and ankle (60.4% vs 40.2%, p=0.0001) from lower body.ParametersCS, yes (n=101)CS, no (n=652)pFemale, n (%)69 (68.3)388 (59.5)0.092ANA-positivity, n (%)22/57 (38.6)190/403 (47.2)0.226HLA B27-positivity, n (%)12/33 (36.4)88/275 (32.0)0.613Onset age, years5.3 (2.7-10.1)6.1 (3.0- 10.4)0.241ESR, mm/h12.0 (5.0-31.0)7.0 (3.0- 18.0)0.0006CRP, mg/l3.9 (0.0- 20.0)1.1 (0.0-9.2)0.002Active joints, n (%)16.0 (9.0-28.0)5.0 (3.0-10.0)0.000000Time before remission, years2.9 (1.5-5.1)2.2 (1.1-4.6)0.046OligoarthritisPolyarthritisPsoriatic arthritisEnthesitis-related arthritisSystemic arthritis5 (5.0)48 (48.0)7 (7.0)22 (21.8)19 (18.9)199 (30.5)217 (33.3)33 (5.1)164 (25.2)39 (6.0)0.0000001Uveitis, n (%)9/76 (11.9)107/444 (24.1)0,018Oral glucocorticosteroids, n (%)37 (36.7)115/651 (17.7)0.00001Biologic, n (%)68 (67.3)283 (43.4)0.000007Remission, n (%)57 (56.4)428 (65.6)0.072Flare, n (%)10 (9.9)128/651 (19.7)0.018Conclusion:The main risk factors of CS involvement in JIA were polyarthicular and systemic arthritis, high inflammatory activity and involvement of joints of upper body. Patients with CS involvement required more often biologics.Disclosure of Interests:None declared
BackgroundJuvenile idiopathic arthritis with systemic onset (soJIA) may have monocycling, polycycling or relapsed course [1]. There were not known soJIA course predictors.ObjectivesThe aim of our study was to evaluate initial clinical or laboratory features of the patients with soJIA who had monocyclic course without biologics.MethodsIn the present study were included data about 130 soJIA patients. After selection we identified a subgroup of the soJIA patients (n=22) who successfully achieved remission without any biologic medication and were stable in the remission off-medication at least two years. The second group consisted of the patients with chronic persistent course (n=83). The remained 25 patients were excluded due to missing data or who did not meet the selection criteria. We evaluated routine clinical (fever, rash, hepatosplenomegaly, serositis, lymphadenopathy, MAS, joint involvement) and laboratorial (WBC, PLT, Hb, ferritin, ALS, AST, LDH, GGTP, ALP, albumin, Na, triglycerids, ESR, CRP, prothrombin, fibrinogen) soJIA features in the onset of the disease.ResultsPatient with monocycling course have no any differences except the ferritin level: 275 (133; 698) ng/ml vs 950 (150; 3240) ng/ml, (p=0.04), time to achievement remission 17.7 (8.2; 38.0) months vs 60.2 (36.0; 99.0) months (p=0.00002) and rare elbow involvement 4.6% vs 30.9% (p=0.01). The parameters, associated with possible monocycling course are in the table.Table. The parameters, associated with possible monocyclic course in soJIA patients.ParameterAUC (95%CI)SeSpOR (95% CI)pCRP≤3.1 mg/dl0.59 (0.48; 0.69)0.530773.6 (1.3; 10.3)0.014ESR≤ 53 mm/h0.62 (0.51; 0.71)0.90.436.8 (1.5; 31.3)0.006Ferritin ≤1340 ng/ml0.69 (0.58; 0.79)1.00.46-0.003Active joints < 80.5 (0.4; 0.6)0.820.394.6 (1.3; 16.8)0.013Onset age <7 years0.57 (0.47; 0.66)0.860.44.2 (1.5; 15.3)0.022No elbow involvement, n (%)-0.960.319.4 (1.2; 73.6)0.012ConclusionPatients with soJIA initially have quit similar clinical presentations independently the further clinical course. The prediction of possible course of soJIA is a difficult problem. Patients with soJIA with monocycling course were younger and had less impressive laboratory activity. Further investigations required.Reference:[1] Cimaz R. Systemic-onset juvenile idiopathic arthritis. Autoimmun Rev. 2016;15(9):931-4.Disclosure of InterestsNone declared
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.