ZRF1 controls oncogene-induced senescence through the INK4-ARF locus

Ribeiro, Joana D.; Morey, Lluís; Más, Antonio; Gutiérrez, Arantxa; Luis, Nuno Miguel; Mejetta, Stefania; Richly, Holger; Benitah, Salvador Aznar; Keyes, William M.; Croce, Luciano Di

doi:10.1038/onc.2012.241

Cited by 30 publications

(36 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Each experiment was repeated twice. The primer sequences for ZRF1 amplification were 5′ C G C T C T G A C C T C T G C C T C T A 3 ′ a n d 5 ′ CAGAAGCATTTCTGTTTCTCCT 3′ [25]. GAPDH was used as an internal control and primer sequence were 5′ T G T T G C C AT C A AT G A C C C C T T C 3 ′ a n d 5 ′ CTCCACGACGTACTCAGCGC 3′.…”

Section: Real-time Pcr Analysesmentioning

confidence: 99%

Silencing of ZRF1 impedes survival of estrogen receptor positive MCF-7 cells and potentiates the effect of curcumin

et al. 2016

View full text Add to dashboard Cite

The role and clinical implication of ZRF1 in breast cancer are poorly understood. So this study is aimed to explore the role of ZRF1 in breast cancer progression. With this context, we first assessed its expression pattern in FFPE primary and metastasis breast tissue samples as well as from publicly available databases. Moreover, we also explored the survival status of patients from the publicly available database and interestingly discover that high expression of ZRF1 decreases the survival of estrogen-positive breast cancer patients more than estrogen-negative status patients. In the perspective of this, we evaluated the role ZRF1 in MCF-7 breast cancer cells and found that it's silencing by knockdown results in decreased cell proliferation as well as cell viability. Results also show that expression of ZRF1 is down regulated in the presence of estrogen-depleted conditions but independent of RAS/MEK as well as AKT axes. Moreover, the decrease in viability of MCF-7 cells was accompanied by induction of apoptosis and DNA damage, well-marked with upregulation of cleaved PARP and downregulation of BCL2 and H2AUbK119 levels. Furthermore, we also explored that knockdown of ZRF1 sensitises the effect of curcumin, observed with decrease in cell viability and dropping of IC50 value from 25 to 15 μM. This investigation thus shed a new light on the role on ZRF1 in breast cancer cells and hence can be exploited to design better therapeutic intervention.

show abstract

Section: Real-time Pcr Analysesmentioning

confidence: 99%

Silencing of ZRF1 impedes survival of estrogen receptor positive MCF-7 cells and potentiates the effect of curcumin

et al. 2016

View full text Add to dashboard Cite

show abstract

“…RAC also binds to ribosomes and is required for the interaction of Ssb with nascent chains (39)(40)(41). RAC/Ssb is connected to diverse cellular functions, including cotranslational folding (38,42,43), translational fidelity (44,45), and transcriptional regulation (46)(47)(48)(49). Recently, we found that RAC/Ssb also plays a role in the quality control of nonstop proteins and of model proteins that possess a bona fide stop codon but contain a C-terminal polylysine segment (termed polylysine proteins) (32).…”

mentioning

confidence: 99%

Release Factor eRF3 Mediates Premature Translation Termination on Polylysine-Stalled Ribosomes in Saccharomyces cerevisiae

Chiabudini

Tais

Zhang

et al. 2014

Molecular and Cellular Biology

View full text Add to dashboard Cite

bRibosome stalling is an important incident enabling the cellular quality control machinery to detect aberrant mRNA. Saccharomyces cerevisiae Hbs1-Dom34 and Ski7 are homologs of the canonical release factor eRF3-eRF1, which recognize stalled ribosomes, promote ribosome release, and induce the decay of aberrant mRNA. Polyadenylated nonstop mRNA encodes aberrant proteins containing C-terminal polylysine segments which cause ribosome stalling due to electrostatic interaction with the ribosomal exit tunnel. Here we describe a novel mechanism, termed premature translation termination, which releases C-terminally truncated translation products from ribosomes stalled on polylysine segments. Premature termination during polylysine synthesis was abolished when ribosome stalling was prevented due to the absence of the ribosomal protein Asc1. In contrast, premature termination was enhanced, when the general rate of translation elongation was lowered. The unconventional termination event was independent of Hbs1-Dom34 and Ski7, but it was dependent on eRF3. Moreover, premature termination during polylysine synthesis was strongly increased in the absence of the ribosome-bound chaperones ribosome-associated complex (RAC) and Ssb (Ssb1 and Ssb2). On the basis of the data, we suggest a model in which eRF3-eRF1 can catalyze the release of nascent polypeptides even though the ribosomal A-site contains a sense codon when the rate of translation is abnormally low.

show abstract

“…In this regard, our data suggest that, by developing strategies to recruit Zrf1 to chromatin and sustain its transcriptional effect, Zrf1 is a potential target for regenerative medicine. As Zrf1 has been shown previously to be involved in oncogene-induced senescence (Ribeiro et al 2013) and misregulated in several human tumors (Shoji et al 1995;Resto et al 2000;Greiner et al 2003), we suggest that Zrf1 could also play a role in brain tumor development. How Zrf1 is recruited to chromatin and, once there, specifically regulates different processes (senescence, specification of NPCs, NPC maintenance, and differentiation) remains to be addressed.…”

Section: Discussionmentioning

confidence: 91%

Zrf1 is required to establish and maintain neural progenitor identity

et al. 2014

View full text Add to dashboard Cite

The molecular mechanisms underlying specification from embryonic stem cells (ESCs) and maintenance of neural progenitor cells (NPCs) are largely unknown. Recently, we reported that the Zuotin-related factor 1 (Zrf1) is necessary for chromatin displacement of the Polycomb-repressive complex 1 (PRC1). We found that Zrf1 is required for NPC specification from ESCs and that it promotes the expression of NPC markers, including the key regulator Pax6. Moreover, Zrf1 is essential to establish and maintain Wnt ligand expression levels, which are necessary for NPC self-renewal. Reactivation of proper Wnt signaling in Zrf1-depleted NPCs restores Pax6 expression and the self-renewal capacity. ESC-derived NPCs in vitro resemble most of the characteristics of the self-renewing NPCs located in the developing embryonic cortex, which are termed radial glial cells (RGCs). Depletion of Zrf1 in vivo impairs the expression of key self-renewal regulators and Wnt ligand genes in RGCs. Thus, we demonstrate that Zrf1 plays an essential role in NPC generation and maintenance.

show abstract

ZRF1 controls oncogene-induced senescence through the INK4-ARF locus

Cited by 30 publications

References 38 publications

Silencing of ZRF1 impedes survival of estrogen receptor positive MCF-7 cells and potentiates the effect of curcumin

Silencing of ZRF1 impedes survival of estrogen receptor positive MCF-7 cells and potentiates the effect of curcumin

Release Factor eRF3 Mediates Premature Translation Termination on Polylysine-Stalled Ribosomes in Saccharomyces cerevisiae

Zrf1 is required to establish and maintain neural progenitor identity

Contact Info

Product

Resources

About