Yin Yang 1 Intronic Binding Sequences and Splicing Elicit Intron-Mediated Enhancement of Ubiquitin C Gene Expression

Bianchi, Marzia; Crinelli, Rita; Giacomini, Elisa; Carloni, Elisa; Radici, Lucia; Magnani, Mauro

doi:10.1371/journal.pone.0065932

Cited by 20 publications

(41 citation statements)

References 62 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This is not in contrast with the previous evidence that transfection of Sp1/Sp3 raises the expression of the intron-retaining and intron-less constructs because the enhancement observed could be due to Sp1/Sp3 interaction with the upstream binding sites (contained in both constructs), previously identified by Marinovic et al [31]. On the other hand, when the two YY1 intronic binding sites were mutated, a statistically significant drop in luciferase activity was observed [39].…”

Section: Ubc Transcriptional Regulationcontrasting

confidence: 84%

“…PPAR binding site was identified by Kim [36]. YY1 intronic binding sites were identified by Bianchi et al [39].…”

Section: Discussionmentioning

confidence: 99%

“…Cotransfection experiments, using the construct −371/+878, harboring the intron, and the respective intron-less construct with an Sp1 or Sp3 expression vector showed, for both the reporter constructs, a statistically significant raise in luciferase expression, meaning that these two factors may be involved, in vivo, in UbC expression. Unexpectedly, mutagenesis of Sp1/Sp3 intronic binding sites didn't result in a drop in luciferase transcripts, indicating that, despite the in vitro evidences (EMSA and supershift), they don't have an in vivo importance in promoting UbC expression [39]. This is not in contrast with the previous evidence that transfection of Sp1/Sp3 raises the expression of the intron-retaining and intron-less constructs because the enhancement observed could be due to Sp1/Sp3 interaction with the upstream binding sites (contained in both constructs), previously identified by Marinovic et al [31].…”

Section: Ubc Transcriptional Regulationmentioning

confidence: 94%

See 2 more Smart Citations

Ubiquitin C gene: Structure, function, and transcriptional regulation

Radici¹,

Bianchi²,

Crinelli³

et al. 2013

ABB

Self Cite

View full text Add to dashboard Cite

Ubiquitin C (UbC) is one of the four genes encoding for ubiquitin in the mammalian genome. It has been described as the most responsive gene to cellular treats such as UV irradiation, heat shock, oxidative stress and translational impairment; it was also re- ported to contribute to maintaining ubiquitin steady state levels under physiological conditions. Despite the bulk of knowledge concerning its function, little is known about the molecular mechanisms modulating UbC expression. Here we review the state of the art of UbC structure, function and transcriptional regula- tion. Starting from the first evidences which circum- scribed the genomic region, pointing out both basic promoter marks (such as transcription start site and TATA-like element), and transcript structure (exon- intron boundaries) we go through more detailed mo- lecular studies performed by Marinovic in 2002 and by Bianchi et al. in 2009 and 2013. Herein, the key players orchestrating UbC gene basal activity are underlined

show abstract

Section: Ubc Transcriptional Regulationcontrasting

confidence: 84%

“…PPAR binding site was identified by Kim [36]. YY1 intronic binding sites were identified by Bianchi et al [39].…”

Section: Discussionmentioning

confidence: 99%

Section: Ubc Transcriptional Regulationmentioning

confidence: 94%

See 1 more Smart Citation

Ubiquitin C gene: Structure, function, and transcriptional regulation

Radici¹,

Bianchi²,

Crinelli³

et al. 2013

ABB

Self Cite

View full text Add to dashboard Cite

show abstract

“…This variant expressed slightly more EmGFP than UBCs, presumably due to improved nuclear export from splicing, but significantly less than UBC (Figure 4C ). These results are consistent with a follow-up study on the UBC promoter fragment intron, which found that its enhancer activity was fully dependent on its position within the intron ( 15 ). This behavior, termed intron-mediated enhancement, is poorly understood.…”

Section: Resultssupporting

confidence: 91%

Rescue of splicing-mediated intron loss maximizes expression in lentiviral vectors containing the human ubiquitin C promoter

Cooper

Lill

Gschweng

et al. 2014

Nucleic Acids Research

View full text Add to dashboard Cite

Lentiviral vectors almost universally use heterologous internal promoters to express transgenes. One of the most commonly used promoter fragments is a 1.2-kb sequence from the human ubiquitin C (UBC) gene, encompassing the promoter, some enhancers, first exon, first intron and a small part of the second exon of UBC. Because splicing can occur after transcription of the vector genome during vector production, we investigated whether the intron within the UBC promoter fragment is faithfully transmitted to target cells. Genetic analysis revealed that more than 80% of proviral forms lack the intron of the UBC promoter. The human elongation factor 1 alpha (EEF1A1) promoter fragment intron was not lost during lentiviral packaging, and this difference between the UBC and EEF1A1 promoter introns was conferred by promoter exonic sequences. UBC promoter intron loss caused a 4-fold reduction in transgene expression. Movement of the expression cassette to the opposite strand prevented intron loss and restored full expression. This increase in expression was mostly due to non-classical enhancer activity within the intron, and movement of putative intronic enhancer sequences to multiple promoter-proximal sites actually repressed expression. Reversal of the UBC promoter also prevented intron loss and restored full expression in bidirectional lentiviral vectors.

show abstract

“…TGCTCGAATGAACACTCTGG TCCTCTGTCAGCATCACCTG according to the manufacturer's instructions, as described in [26]. Briefly, HeLa cells were treated with 80 lM NaAsO 2 , 20 lM MG132 for 4 h at 37°C or left untreated (control).…”

Section: Chromatin Immunoprecipitation and Pcr Of Chromatin Templatesmentioning

confidence: 99%

Induction of ubiquitin C (UBC) gene transcription is mediated by HSF1: role of proteotoxic and oxidative stress

et al. 2018

Self Cite

View full text Add to dashboard Cite

The polyubiquitin gene ubiquitin C ( UBC ) is considered a stress protective gene and is upregulated under various stressful conditions, which is probably a consequence of an increased demand for ubiquitin in order to remove toxic misfolded proteins. We previously identified heat shock elements ( HSE s) within the UBC promoter, which are responsible for heat shock factor ( HSF )1‐driven induction of the UBC gene and are activated by proteotoxic stress. Here, we determined the molecular players driving the UBC gene transcriptional response to arsenite treatment, mainly addressing the role of the nuclear factor‐erythroid 2‐related factor 2 (Nrf2)‐mediated antioxidant pathway. Exposure of HeLa cells to arsenite caused a time‐dependent increase of UBC mRNA , while cell viability and proteasome activity were not affected. Nuclear accumulation of HSF 1 and Nrf2 transcription factors was detected upon both arsenite and MG 132 treatment, while HSF 2 nuclear levels increased in MG 132‐treated cells. Notably, si RNA ‐mediated knockdown of Nrf2 did not reduce UBC transcription under either basal or stressful conditions, but significantly impaired the constitutive and inducible expression of well‐known antioxidant response element‐dependent genes. A chromatin immunoprecipitation assay consistently failed to detect Nrf2 binding to the UBC promoter sequence. By contrast, depletion of HSF 1, but not HSF 2, significantly compromised stress‐induced UBC expression. Critically, HSF 1‐mediated UBC trans ‐activation upon arsenite exposure relies on transcription factor binding to previously mapped distal HSE s, as demonstrated to occur under proteasome inhibition. These data highlight HSF 1 as the pivotal transcription factor that translates different stress signals into UBC gene transcriptional induction.

show abstract

Yin Yang 1 Intronic Binding Sequences and Splicing Elicit Intron-Mediated Enhancement of Ubiquitin C Gene Expression

Cited by 20 publications

References 62 publications

Ubiquitin C gene: Structure, function, and transcriptional regulation

Ubiquitin C gene: Structure, function, and transcriptional regulation

Rescue of splicing-mediated intron loss maximizes expression in lentiviral vectors containing the human ubiquitin C promoter

Induction of ubiquitin C (UBC) gene transcription is mediated by HSF1: role of proteotoxic and oxidative stress

Contact Info

Product

Resources

About