YAP Inhibition by Resveratrol via Activation of AMPK Enhances the Sensitivity of Pancreatic Cancer Cells to Gemcitabine

Jiang, Zhengdong; Chen, Xin; Chen, Ke; Sun, Liankang; Gao, Luping; Zhou, Cancan; Meng, Lingjun; Duan, Wanxing; Wang, Zheng; Ma, Qingyong; Ma, Jiguang

doi:10.3390/nu8100546

Cited by 60 publications

(63 citation statements)

References 46 publications

(56 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A Prime Script RT reagent kit (TaKaRa, Dalian, China) was used to reverse‐transcribe the total RNA into cDNA. Quantitative real‐time PCR was performed as previously described (Jiang et al ., ). The PCR primer sequences used were as follows: HSF1 forward ACCCATGCTTCCTGCGTGGC, reverse TGCTTCTGCCGAAGGCTGGC; HSPH1, forward CACCAGAAAACCCAGACACT, reverse GGGAGACTGTGAGGTTTGTT; HSPA6, forward AGCAGTTGTGGCACTCAAG, reverse TCACAGCTGACTTATCACGAAG; HSPE1, forward ACACTAGAGCAGAGTACGAGTC, reverse CAGCACTCCTTTCAACCAATAC; and β‐actin, forward AGCGAGTATCCCCCAAAGTT, reverse GGGCACGAAGGCTCATCATT.…”

Section: Methodsmentioning

confidence: 97%

Loss of AMPK activation promotes the invasion and metastasis of pancreatic cancer through an HSF1‐dependent pathway

Chen

Qian

et al. 2017

Molecular Oncology

Self Cite

View full text Add to dashboard Cite

Pancreatic ductal adenocarcinoma (PDAC) is a lethal malignancy with a mortality rate that closely parallels its incidence rate, and a better understanding of the molecular and cellular mechanisms associated with the invasion and distant metastasis is required. Heat shock factor 1 (HSF1) is a very highly conserved factor in eukaryotes that regulates the protective heat shock response. Here, we show that HSF1 is abnormally activated in pancreatic cancer. The knockdown of HSF1 impaired the invasion and migration and epithelial–mesenchymal transition (EMT) of pancreatic cancer cells in vitro; however, the upregulation of HSF1 showed the opposite effects. In vivo, the pharmacological inhibition of HSF1 significantly reduced the tumor burden, decreased the incidence of invasion, and prolonged the overall survival of transgenic mice harboring the spontaneous pancreatic cancer. We suggest that the loss of AMP‐activated protein kinase (AMPK) activation mediates the abnormal activation of HSF1 based on the findings that phospho‐HSF1 (p‐HSF1) was highly expressed in human PDAC tissues with a low expression of p‐AMPK and that in those tissues with a high p‐AMPK expression, the level of p‐HSF1 was decreased. The in vivo and in vitro activation of AMPK impaired the activity of HSF1, and HSF1 mediated the effects of the AMPK knockdown‐induced pancreatic cancer invasion and migration. Our study revealed a novel mechanism by which the loss of AMPK activation amplifies the activity of HSF1 to promote the invasion and metastasis of pancreatic cancer.

show abstract

Section: Methodsmentioning

confidence: 97%

Loss of AMPK activation promotes the invasion and metastasis of pancreatic cancer through an HSF1‐dependent pathway

Chen

Qian

et al. 2017

Molecular Oncology

Self Cite

View full text Add to dashboard Cite

show abstract

“…Resveratrol was documented to interact with the complex tumor microenvironment network, a precondition for tumor growth, progression and metastasis. Particularly it was seen to play a key role in the apoptotic signaling of the tumor cell through direct stimulation of caspases cascade and the inhibition of the anti-apoptotic pathways such as PTEN/PI3K/AKT, Sirt-1, AMPK/YAP, NF-κB and STAT3 that contribute to tumor cell immortality [75][76][77][78][79][80]. The anti-proliferative property of resveratrol occurs with the enhancement of p21 and thus p53 activity.…”

Section: Pharmacodynamic Properties Of Resveratrolmentioning

confidence: 99%

Resveratrol in Cancer Patients: From Bench to Bedside

Berretta

Bignucolo

Francia

et al. 2020

IJMS

View full text Add to dashboard Cite

Resveratrol (3,5, is a natural phytoalexin that accumulates in several vegetables and fruits like nuts, grapes, apples, red fruits, black olives, capers, red rice as well as red wines. Being both an extremely reactive molecule and capable to interact with cytoplasmic and nuclear proteins in human cells, resveratrol has been studied over the years as complementary and alternative medicine (CAM) for the therapy of cancer, metabolic and cardiovascular diseases like myocardial ischemia, myocarditis, cardiac hypertrophy and heart failure. This review will describe the main biological targets, cardiovascular outcomes, physico-chemical and pharmacokinetic properties of resveratrol in preclinical and clinical models implementing its potential use in cancer patients.properties of resveratrol are, however, marked by a pharmacokinetic profile and by an unfavorable oral bioavailability, which requires a thorough analysis. To date, to the best of our knowledge, scientific papers and reviews summarizing multiple characteristics of resveratrol, its pharmacokinetic, pharmacodynamic profiles and potential drug interaction in oncology are lacking in literature. Therefore, this review aimed to describe the potential use of resveratrol in cancer management presenting the main biochemical pathways involved, issues and potential uses in cancer patients. Moreover, the involvement of resveratrol in cardioncology, its potential use for risk reduction of myocardial ischemia, myocarditis, cardiac hypertrophy as well as heart failure are also discussed. To endorse this review, we made a comprehensive search on PubMed, Web of Science and SciFinder. The search terms were "resveratrol" combined with "cardioncology" or "cancer" or "drug-food" or "cardiology" or "pharmacokinetic" or "pharmacodynamic". Physico-Chemical and Pharmacokinetic Properties of ResveratrolResveratrol is a low molecular weight phyto-polyphenol of 228 Da that appears as an off-white powder with lipophilic properties (octanol/water partition coefficient, log Kow = 3.1). Its melting point is between 253 and 255 • C, and its solubility in water is very low (3 mg/100 mL) [8]. The ethylene bridge due to a limited degree of freedom generates two geometric isomers: cis-resveratrol and trans-resveratrol ( Figure 1) [5]. These isoforms co-exist in resveratrol extracts even if a greater biological activity and stability are attributed to trans-resveratrol. Comparing to the geometric isomers, the nearly planar structure of trans-resveratrol is less flexible than the non-planar structure of cis-resveratrol, but it possesses a lower repulsive energy that ensures it, albeit small, higher stability. Isomerization of trans-resveratrol to cis-resveratrol occurs via molecule breakdown when trans-resveratrol is exposed to UV radiation at a wavelength of 254 or 366 nm, to high pH conditions or in plants during fermentation processes [5,9]. In analyzing some physical-chemical aspects of resveratrol, Zupancic et al. showed how trans-resveratrol is rapidly degradable in high-pH solutions. In par...

show abstract

“…As a result, resveratrol can be used in chemotherapy to protect normal cells to reduce adverse effects owing to this property. In general, the specific molecular mechanisms and signaling pathways involved in the antitumor effect of resveratrol include (1) regulation of mitochondrial and caspase cascade enzymatic system activation; (2) upregulation of cyclin‐dependent kinase inhibitors, tumor suppressor genes, death‐induced cytokines, and their receptors; (3) downregulation of the expression of survival proteins associated with the development of chemoresistance, including survivin, cFLIP, cIAPs, and antiapoptotic proteins (Bcl‐2 and Bcl‐XL); (4) activation of adenosine 5′‐monophosphate–activated protein kinase (AMPK), and (5) inhibition of MAPK, phosphoinositide 3‐kinase (PI3K)/Akt, hedgehog (HH), hippo–YAP, PKC, EGFR kinase, nuclear factor κB (NF‐κB), activating protein‐1 (AP‐1), HIF‐1α, and signal transducer and activator of transcription 3 (STAT3) . However, the exact molecular mechanisms need further investigation.…”

Section: The Main Molecular Mechanisms Of Resveratrol In Killing Tumomentioning

confidence: 99%

“…Resveratrol was assessed on various types of cancers as a chemotherapy sensitizer, including pancreatic cancer, breast cancer, and colon cancer . The mechanisms by which resveratrol chemosensitizes cancer cells include inhibition of tumor cell proliferation, metastasis, and angiogenesis and induction of tumor cell apoptosis through the inhibition of related signaling pathways, such as SIRT1, the STAT3 signaling pathway, the Hh signaling pathway, the AMPK/YAP pathway, and the PTEN/PI3K/AKT and NF‐κB signaling pathway . Resveratrol enhanced the cytotoxicity of anticancer agents through promoting S phase cell cycle arrest accompanied by a significant decrease in levels of proteins involved in drug resistance, such as MRP1, LRP, GST, and BCL‐2, as well as topoisomerase II, in resveratrol treatment groups compared with controls in bladder cancer cells .…”

Section: Resveratrol Sensitizes Cancer Cells To Chemotherapymentioning

confidence: 99%

Resveratrol and cancer treatment: updates

Jiang

Chen

Liu

et al. 2017

Annals of the New York Academy of Sciences

Self Cite

108

View full text Add to dashboard Cite

Cancer, a growing health problem worldwide, affects millions of people every year. The overall survival rates of most cancers have been prolonged owing to the efforts of clinicians and scientists. However, some tumors develop resistance to chemoradiotherapeutic agents, and the cancer research community continues to search for effective sensitizers. Resveratrol, a natural polyphenolic phytoalexin, has shown promising effects in inhibiting proliferation and cancer progression in several tumor models. However, its molecular mechanisms and applications in chemotherapy and radiotherapy have yet to be fully determined. In this concise review, we highlight the role and related molecular mechanisms of resveratrol in cancer treatment. In particular, we focus on the role of resveratrol in the tumor microenvironment and the sensitization of cancer cells for chemotherapy and radiotherapy. Resveratrol shows promising efficacies in cancer treatment and may be applied in clinical therapy, but it requires further clinical study.

show abstract

YAP Inhibition by Resveratrol via Activation of AMPK Enhances the Sensitivity of Pancreatic Cancer Cells to Gemcitabine

Cited by 60 publications

References 46 publications

Loss of AMPK activation promotes the invasion and metastasis of pancreatic cancer through an HSF1‐dependent pathway

Loss of AMPK activation promotes the invasion and metastasis of pancreatic cancer through an HSF1‐dependent pathway

Resveratrol in Cancer Patients: From Bench to Bedside

Resveratrol and cancer treatment: updates

Contact Info

Product

Resources

About