XIST/miR-139 axis regulates bleomycin (BLM)-induced extracellular matrix (ECM) and pulmonary fibrosis through β-catenin

Wang, Yichun; Liang, Ying; Luo, Jun; Nie, Jing; Yin, Huiming; Chen, Qiong; Dong, Jing; Zhu, Jixiang; Xia, Jia-Mei; Wei, Shuai

doi:10.18632/oncotarget.18310

Cited by 20 publications

(15 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Numerous studies have demonstrated that miRNAs are involved in the progression of diseases that occur in different tissues. For example, miR-139 was able to regulate pulmonary fibrosis via β-catenin (19). miR-122 has been demonstrated to be associated with iron overload-mediated hepatic inflammation (20).…”

Section: Discussionmentioning

confidence: 99%

miR-93‑mediated collagen expression in stress urinary incontinence via calpain-2

Yang

Wang

et al. 2017

Mol Med Report

View full text Add to dashboard Cite

The aim of the present study was to investigate the expression and mechanism of microRNA (miR)‑93 in collagen expression in stress urinary incontinence (SUI). Vaginal tissue, primary fibroblasts and SUI primary fibroblasts were obtained to detect the expression of miR‑93, interstitial collagenase (MMP1), collagen I and calpain‑2. Reverse transcription‑quantitative polymerase chain reaction analysis was performed to detect the levels of miR‑93 and MMP1. Western blotting was used to evaluate the protein levels of calpain‑2, MMP1 and collagen I. MMP1 and hydroxyproline levels in the supernatant were measured by ELISA. The association between miR‑93 and calpain‑2 was investigated by luciferase reporter assays. The expression of miR‑93 and collagen I was significantly downregulated in the SUI group, while the expression of calpain‑2 and MMP1 was significantly upregulated. ELISA analysis demonstrated that the MMP1 level increased and the hydroxyproline level decreased in the SUI group. Additionally, calpain‑2 was identified to be a target of miR‑93, and miR‑93 was able to negatively regulate the expression of calpain‑2. Restoration of calpain‑2 in miR‑93‑overexpresseing SUI primary fibroblasts reversed the alteration in hydroxyproline expression, indicating that calpain‑2 was negatively associated with collagen expression. The results of the present study suggested that miR‑93 regulated MMP1 and collagen I expression in fibroblasts via calpain‑2. miR‑93 mediated collagen expression in stress urinary incontinence via calpain‑2.

show abstract

Section: Discussionmentioning

confidence: 99%

miR-93‑mediated collagen expression in stress urinary incontinence via calpain-2

Yang

Wang

et al. 2017

Mol Med Report

View full text Add to dashboard Cite

show abstract

“…The mice in the ALF model group were given intragastric administration with 4.8 g/(kg∙d) spirit, 24 mg/(kg∙d) pyrazole, 2 mL/(kg∙d) corn oil once daily for 12 weeks . Lentivirus targeting sh‐XIST (LV‐sh‐XIST) or the lentivirus negative control (LV‐sh‐NC) were dissolved in saline (10 mg/mL, 0.5 mL) and then injected into ALF model mice via tail vein for another 4 weeks . The sequence of LV‐sh‐XIST was 5′‐AUAACAGUAAGUCUGAUAGAGGACA‐3′.…”

Section: Methodsmentioning

confidence: 99%

“…In particular, XIST is highly expressed in hepatocellular carcinoma tissues and promotes hepatocellular carcinoma progression . In addition, XIST was highly expressed in lung tissues from experimental pulmonary fibrosis (PF) model mice; and XIST knockdown attenuated mouse PF . However, the exact role of XIST in liver fibrosis remains undefined.…”

Section: Introductionmentioning

confidence: 99%

Long noncoding RNA XIST enhances ethanol‐induced hepatic stellate cells autophagy and activation via miR‐29b/HMGB1 axis

et al. 2019

View full text Add to dashboard Cite

Activation of hepatic stellate cells (HSCs) is a prominent driver of liver fibrogenesis, including alcoholic liver fibrosis (ALF). Furthermore, autophagy contributes to HSCs activation. This study aims to investigate the role and the mechanisms of long noncoding RNA XIST in regulating HSCs autophagy and activation. Human HSC cells (LX-2) were treated with 100 mmol/L ethanol to mimic HSCs activation. The HSCs activation was evaluated by determining cell viability and protein levels of fibrosis markers α-smooth muscle actin (α-SMA) and collagen type 1 α1 (CoL1A1). The autophagy was evaluated by measuring autophagy markers Beclin-1 and LC3-II. The interaction among XIST, miR-29b, and high-mobility group box-1 (HMGB1) were analyzed using luciferase reporter assay, qRT-PCR, and western blot. Lentiviruses targeting sh-XIST (LV-sh-XIST) were injected into ALF model mice via tail vein to elucidate the in vivo role of XIST in ALF injury. XIST was upregulated in ethanolactivated LX-2 cells. Furthermore, XIST served as a competitive endogenous RNA of miR-29b to facilitate HMGB1 expression, and thus enhanced ethanol-induced HSCs autophagy and activation. Further in vivo assay showed that downregulation of XIST by LV-sh-XIST alleviated ALF injury in ALF model mice. Collectively, XIST enhances ethanol-induced HSCs autophagy and activation via miR-29b/HMGB1 axis.autophagy, hepatic stellate cells activation, HMGB1, miR-29b, XIST Abbreviations: ALF, alcoholic liver fibrosis; CoL1A1, collagen type 1 α1; ceRNA, competitive endogenous RNA; HMGB, high mobility group protein B1; HMGB1, high-mobility group box-1; HSCs, hepatic stellate cells; HOTAIR, lncRNA HOX transcript antisense RNA; lncRNAs, long noncoding RNAs; LC3-II, microtubule-associated protein 1A/1B-light chain 3; LV-sh-XIST, lentiviruses targeting sh-XIST; LX-2, human HSC cells; MTT, 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide; PF, pulmonary fibrosis; RNA XIST, long noncoding; si-HMGB1, small interfering RNA targeting HMGB1; siRNA, small interfering RNA; si-XIST, small interfering RNA targeting XIST; XIST, LncRNA X-inactive-specific transcript; α-SMA, α-smooth muscle actin.

show abstract

“…However, little is known about miRNA functions in IPF; much of the functional data has been inferred from chemically induced mouse IPF models. In the lungs of mouse IPF models, miR-21, miR-9, and miR-155 were increased [19,21,30], and miR-26, miR-101, miR-139, miR-200, miR-326, miR-489, miR-503, and miR-708 were decreased [24,[31][32][33][34][35][36][37]. Furthermore, miR-21 expression was increased in myofibroblasts from IPF lungs, and its inhibition in mouse IPF models attenuated the disease severity [19].…”

Section: Ipf and Mirnasmentioning

confidence: 99%

The Role of miRNAs in Idiopathic Pulmonary Fibrosis

Takagi¹,

Yamakuchi²,

Hashiguchi³

et al. 2019

Interstitial Lung Diseases

View full text Add to dashboard Cite

Idiopathic pulmonary fibrosis (IPF) is a genetic heterogeneous disease with high mortality and poor prognosis. IPF is characterized by persistent fibroblasts and relentless accumulation of collagen matrix. Epithelial-mesenchymal transition (EMT) and endothelial-to-mesenchymal transition (EndoMT) contribute to the progression of the fibrotic process. There are some therapeutic drugs that delay this progress, but eradicative medicine does not exist yet. MicroRNAs (miRNAs) are short single-stranded RNAs that regulate posttranscriptional silencing. Recent reports have shown that miRNAs play important roles in the development of IPF, as different expression levels of miRNAs in blood and lung tissue from IPF patients were closely associated with the occurrence of IPF disease. In this chapter, we will discuss the role of miRNAs in the pathogenesis, diagnosis, and treatment of IPF. In particular, we will focus on the regulation of EMT/EndoMT by miRNAs.

show abstract

XIST/miR-139 axis regulates bleomycin (BLM)-induced extracellular matrix (ECM) and pulmonary fibrosis through β-catenin

Cited by 20 publications

References 27 publications

miR-93‑mediated collagen expression in stress urinary incontinence via calpain-2

miR-93‑mediated collagen expression in stress urinary incontinence via calpain-2

Long noncoding RNA XIST enhances ethanol‐induced hepatic stellate cells autophagy and activation via miR‐29b/HMGB1 axis

The Role of miRNAs in Idiopathic Pulmonary Fibrosis

Contact Info

Product

Resources

About