X-Ray Structure of the Amidase Domain of AtzF, the Allophanate Hydrolase from the Cyanuric Acid-Mineralizing Multienzyme Complex

Abstract

dThe activity of the allophanate hydrolase from Pseudomonas sp. strain ADP, AtzF, provides the final hydrolytic step for the mineralization of s-triazines, such as atrazine and cyanuric acid. Indeed, the action of AtzF provides metabolic access to two of the three nitrogens in each triazine ring. The X-ray structure of the N-terminal amidase domain of AtzF reveals that it is highly homologous to allophanate hydrolases involved in a different catabolic process in other organisms (i.e., the mineralization of urea). The smaller C-terminal domain does not appear to have a physiologically relevant catalytic function, as reported for the allophanate hydrolase of Kluyveromyces lactis, when purified enzyme was tested in vitro. However, the C-terminal domain does have a function in coordinating the quaternary structure of AtzF. Interestingly, we also show that AtzF forms a large, ca. 660-kDa, multienzyme complex with AtzD and AtzE that is capable of mineralizing cyanuric acid. The function of this complex may be to channel substrates from one active site to the next, effectively protecting unstable metabolites, such as allophanate, from solvent-mediated decarboxylation to a dead-end metabolic product.A trazine (1-chloro-3-ethylamino-5-isopropylamino-2,4,6-triazine; Fig. 1) is one of the most heavily applied herbicides in the world and is registered for use in North and South America, Australia, Africa, Asia, and the Middle East. Atrazine is environmentally persistent (half-life, 4 to 57 weeks, depending on the location) and mobile, leading to the detection of atrazine in surface water, groundwater, and aquifers (1-3). Atrazine has been detected in the environment at concentrations of up to 4.6 M in several countries (2, 3). It has been suggested that atrazine may be a carcinogen and an endocrine disrupter at such concentrations (4-6).Since atrazine was introduced in the 1950s, bacteria have evolved highly efficient catabolic pathways that allow the use of atrazine as a sole nitrogen and carbon source (7-10). These pathways have provided valuable insights into the evolutionary processes that drive the establishment of new enzyme function and new catabolic pathways (11-15). In addition, these pathways and cognate enzymes provide a potential biotechnological solution to atrazine contamination (i.e., bioremediation) (16-19).The most intensively studied atrazine catabolism pathway was discovered in Pseudomonas sp. strain ADP in the mid-1990s and is comprised of six hydrolases: atrazine chlorohydrolase (AtzA; EC 3.8.1.8) (20,21), N-ethylaminohydrolase (AtzB; EC 3.5.99.3) (22,23), N-isopropylammelide isopropylaminohydrolase (AtzC; EC 3.5.99.4) (24, 25), cyanuric acid amidohydrolase (AtzD; EC 3.5.2.15) (15,26,27), biuret amidohydrolase (AtzE; EC 3.5.1.84) (28), and allophanate hydrolase (AtzF; EC 3.5.1.54) (29-31). These hydrolases sequentially dechlorinate (AtzA) and remove the two N-alkyl side groups (AtzB and AtzC) to produce cyanuric acid, which is then further hydrolyzed to biuret, allophanate, and ammonia via AtzD, AtzE, a...

An unexpected vestigial protein complex reveals the evolutionary origins of an s-triazine catabolic enzyme

“…ADP genomic DNA with the primers (5' to 3': CGACGACATATGCTCGAGATGACGGAAA CTG and TGCTGCGAGCTCCCTAGGTCAGATATCTT CTGC), before being subcloned into the second cloning site of the pACYCDuet-1 vector using the enzymes NdeI and XhoI. The atzD coding for the protein NP_862537 (NP_862537.1) had been cloned into pETcc2 previously (11,13,18). Ligations were performed using T4 ligase.…”

“…We therefore propose that AtzE deaminates 1-carboxybiuret, producing 1,3-dicarboxyurea (Fig. 1B), which then monodecarboxylates to form allophanate (the substrate for AtzF) (13,15). Currently, it is unclear if the formation of allophanate is spontaneous or enzyme-mediated.…”

“…The catalytic mechanism of AtzE is likely to resemble that of other enzymes with SercisSer-Lys catalytic triads (e.g., malonamidase, allophanate amidohydrolase, DNA polymerase V accessory protein, and signal peptidase) (13,(26)(27)(28). The catalytic triad of AtzE, inferred from crystallographic data and homology with other amidases, comprises of Lys74, cisSer150 and Ser174.…”

“…1B) is also comprised of three hydrolases: AtzD, AtzE and AtzF. Unlike the upper pathway, these three enzymes are serine hydrolases; AtzD is an unusual Ser-Lys hydrolase and is the archetype of a recently discovered protein fold (the Toblerone fold; (11,12)), while AtzE and AtzF are Ser-cisSer-Lys hydrolases (1,13). The lower pathway progresses via the AtzD-mediated ring opening of cyanuric acid to form an unstable product, 1-carboxybiuret, which is known to spontaneously decarboxylate to biuret in an aqueous environment (1).…”

“…It was therefore thought that the proceeding catabolic steps consisted of the deamination of biuret by AtzE to form allophanate, and allophanate deamination by AtzF to form carbamic acid. Interestingly, these enzymatic products are unstable in an aqueous environment and can undergo spontaneous reactions; allophanate decarboxylates to urea (14), whilst carbamic acid decomposes to ammonia and carbon dioxide in water (13,15). AtzD and AtzF have been overproduced in heterologous expression systems, which has allowed them to be studied biochemically (14)(15)(16)(17) and structurally (11)(12)(13)18).…”