X-linked intellectual disability gene CASK regulates postnatal brain growth in a non-cell autonomous manner

Abstract

The phenotypic spectrum among girls with heterozygous mutations in the X-linked intellectual disability (XLID) gene CASK (calcium/calmodulin-dependent serine protein kinase) includes postnatal microcephaly, ponto-cerebellar hypoplasia, seizures, optic nerve hypoplasia, growth retardation and hypotonia. Although CASK knockout mice were previously reported to exhibit perinatal lethality and a 3-fold increased apoptotic rate in the brain, CASK deletion was not found to affect neuronal physiology and their electrical properties. The pathogenesis of CASK associated disorders and the potential function of CASK therefore remains unknown. Here, using Cre-LoxP mediated gene excision experiments; we demonstrate that deleting CASK specifically from mouse cerebellar neurons does not alter the cerebellar architecture or function. We demonstrate that the neuron-specific deletion of CASK in mice does not cause perinatal lethality but induces severe recurrent epileptic seizures and growth retardation before the onset of adulthood. Furthermore, we demonstrate that although neuron-specific haploinsufficiency of CASK is inconsequential, the CASK mutation associated human phenotypes are replicated with high fidelity in CASK heterozygous knockout female mice (CASK(+/-)). These data suggest that CASK-related phenotypes are not purely neuronal in origin. Surprisingly, the observed microcephaly in CASK(+/-) animals is not associated with a specific loss of CASK null brain cells indicating that CASK regulates postnatal brain growth in a non-cell autonomous manner. Using biochemical assay, we also demonstrate that CASK can interact with metabolic proteins. CASK knockdown in human cell lines cause reduced cellular respiration and CASK(+/-) mice display abnormalities in muscle and brain oxidative metabolism, suggesting a novel function of CASK in metabolism. Our data implies that some phenotypic components of CASK heterozygous deletion mutation associated disorders represent systemic manifestation of metabolic stress and therefore amenable to therapeutic intervention.Electronic supplementary materialThe online version of this article (doi:10.1186/s40478-016-0295-6) contains supplementary material, which is available to authorized users.

Optic Nerve Hypoplasia Is a Pervasive Subcortical Pathology of Visual System in Neonates

“…3 C). Indeed, we have previously documented that CASK promotes postnatal brain growth in a non-cell autonomous manner 24 (i.e., CASK + and CASK − cells are equally affected). We therefore tested if there is specific loss of only CASK negative axons in CASK (+/−) mice.…”

“…Previously, we documented that CASK (+/−) mice exhibit secondary microcephaly, disproportionate cerebellar hypoplasia, as well as thinning and hypoplasia of the optic nerve indicating that it recapitulates the human phenotypes associated with CASK mutation or loss. 24 We examined optic nerves following toluidine blue staining of semithin cross-sections—a method that labels myelin and allows the quantification of myelinated retinal axons in the ON. Surprisingly, besides being small ( Figs.…”

“…CASK (+/−) female mice, generated in house, 24 were crossed with C57BL6 male mice to propagate CASK (+/−) female pups and their CASK (+/+) female littermates. Genotyping was done using a PCR-based method with following primer pair (forward: TTTGGGGACTAGATGGGTGTGGTG, reverse: CTTGGTCGCAGCTTGGGAGTA).…”

Genetic causes of optic nerve hypoplasia

“…Other ophthalmological abnormalities include hyperopia, strabismus, astigmatism and nystagmus. Constitutive knockout mice ( Cask − /y and Cask − /− ) die within the first day after birth,75 but deletion of a single Cask allele ( Cask +/ − ) in female mice has been found to recapitulate many human phenotypes, including microcephaly, hypotonia, ataxia and ONH without microphthalmia or malformation of the brain midline 79. The study suggested that Cask regulates oxidative metabolism in the brain, and the rate of glucose oxidation was reduced by 20% in the brain of Cask +/ − mice compared with wild-type littermates 79…”

Presynaptic dysfunction inCASK-related neurodevelopmental disorders

“…Reports of XCI in adult human tissues did not indicate CASK as likely XCI escape gene (Tukiainen et al, 2017). Heterozygous CASK knockout mice that recapitulate the MICPCH phenotype showed CaskWT expression in 50% of neurons suggesting that XCI is stable in CASK-negative neurons (Mori et al, 2019;Srivastava et al, 2016). The stability of XCI during iPSC re-programing varies between protocols, and activation of both X chromosomes with subsequent random silencing of one X has been observed (Dandulakis et al, 2016).…”