wnt16 regulates spine and muscle morphogenesis through parallel signals from notochord and dermomyotome

Abstract

Bone and muscle are coupled through developmental, mechanical, paracrine, and autocrine signals. Genetic variants at the CPED1-WNT16 locus are dually associated with bone- and muscle-related traits. While Wnt16 is necessary for bone mass and strength, this fails to explain pleiotropy at this locus. Here, we show wnt16 is required for spine and muscle morphogenesis in zebrafish. In embryos, wnt16 is expressed in dermomyotome and developing notochord, and contributes to larval myotome morphology and notochord elongation. Later, wnt16 is expressed at the ventral midline of the notochord sheath, and contributes to spine mineralization and osteoblast recruitment. Morphological changes in wnt16 mutant larvae are mirrored in adults, indicating that wnt16 impacts bone and muscle morphology throughout the lifespan. Finally, we show that wnt16 is a gene of major effect on lean mass at the CPED1-WNT16 locus. Our findings indicate that Wnt16 is secreted in structures adjacent to developing bone (notochord) and muscle (dermomyotome) where it affects the morphogenesis of each tissue, thereby rendering wnt16 expression into dual effects on bone and muscle morphology. This work expands our understanding of wnt16 in musculoskeletal development and supports the potential for variants to act through WNT16 to influence bone and muscle via parallel morphogenetic processes.

Examining craniofacial variation among crispant and mutant zebrafish models of human skeletal diseases

“…Additionally, recent evidence from crispant zebrafish models support the potential for wnt16 to exert pleiotropic effects on bone and lean muscle mass through a function in myogenic precursors. (Watson et al, 2022). With the exception of the occipital region, all other areas of the skull that vary between wnt16 crispants and controls are associated with the expansion of the oral cavity required for suction feeding in fishes (Day et al, 2015).…”

“…We also included germline mutant lines for sost (7 mutants; 9 heterozygotes; 8 control fish) and wnt16 (5 mutants; 6 heterozygotes; 3 control fish). Generation of crispants for plod2 and wnt16 was previously described (Watson et al, 2020; 2022); Generation of crispants for meox1 was performed using the methods described in Watson et al, 2020. In this case, Cas9:gRNAs targeting two distinct regions (gRNA1: GTCAGGAGTCCTCATTCGGG; gRNA2: GGTTGACTGCGATCTCGTAG) were injected.…”

“…In this case, Cas9:gRNAs targeting two distinct regions (gRNA1: GTCAGGAGTCCTCATTCGGG; gRNA2: GGTTGACTGCGATCTCGTAG) were injected. Germline mutants for wnt16 ( wnt16 w1001 ) were previously described in Watson et al, 2022. Germline mutants for sost ( Tg [ sost :NTR‐GFP] w216 ) were previously described (Thomas & Raible, 2019).…”

“…Germline mutants for sost ( Tg [ sost :NTR‐GFP] w216 ) were previously described (Thomas & Raible, 2019). Mutant alleles for both wnt16 and sost are both predicted to function as null alleles (Thomas & Raible, 2019; Watson et al, 2022). Studies were conducted in mixed sex animals.…”

Wnt16 signaling in bone homeostasis and osteoarthristis

“…The spatiotemporal expression of Wnt16 has been described by several studies: during embryonic development, Wnt16 is selectively expressed in mouse perichondrium, periosteum and joints, and in zebrafish dermomyotome and developing notochord ( 105 , 106 ), while in postnatal environment, Wnt16 is highly expressed in mouse cortical bone and zebrafish notochord sheath ( 56 , 105 ). Researches have suggested that changes in hormone level caused by aging, diseases and hormone therapy can affect the expression of Wnt16.…”