Whole-mount fluorescence in situ hybridization to visualize symbiotic bacteria in the gills of deep‑sea mussels

Fujinoki, Masaru; Koito, Tomoko; Fujiwara, Yoshihiro; Kawato, Masaru; Tada, Yuya; Hamasaki, Koji; Jimbo, Mitsuru; Inoue, Koji

doi:10.3354/ab00385

Cited by 8 publications

(3 citation statements)

References 12 publications

(17 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We utilized specimens of B. platifrons for which the technique of whole‐mount fluorescence in situ hybridization has already been established (Fujinoki et al. ) to localize the newly found alveolate protist (see below) in the gill tissue. After sampling, individuals of B. platifrons were immediately preserved in 70% ethanol on board.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

A Novel Alveolate in Bivalves with Chemosynthetic Bacteria Inhabiting Deep‐Sea Methane Seeps

Noguchi

Kawato

Yoshida

et al. 2013

J Eukaryotic Microbiology

View full text Add to dashboard Cite

It has recently been unveiled that a wide variety of microbial eukaryotes (protists) occur in chemosynthetic ecosystems, such as hydrothermal vents and methane seeps. However, there is little knowledge regarding protists associated with endemic animals inhabiting these environments. In the present study, utilizing PCR techniques, we detected fragments of the small subunit ribosomal RNA gene (SSU rRNA gene) from a particular protist from gill tissues of a significant fraction of the vesicomyid clams Calyptogena soyoae and C. okutanii complex and of the mussel Bathymodiolus platifrons and B. japonicus, all of which harbor chemosynthetic endosymbiont bacteria and dominate methane seeps in Sagami Bay, Japan. Based on the phylogeny of SSU rRNA gene, the organism in question was shown to belong to Alveolata. It is noteworthy that this protist did not affiliate with any known alveolate group, although being deeply branched within the lineage of Syndiniales, for which the monophyly was constantly recovered, but not robustly supported. In addition, the protist detected using PCR followed by sequencing was localized within gill epithelial cells of B. platifrons with whole-mount fluorescence in situ hybridization. This protist may be an endoparasite or an endocommensal of Calyptogena spp. and Bathymodiolus spp., and possibly have physiological and ecological impacts on these bivalves.

show abstract

Section: Methodsmentioning

confidence: 99%

“…Whole‐mount fluorescence in situ hybridization was performed according to Fujinoki et al. () except that Alexa555‐labeled probe SymMx (Fujiwara et al. ) and Alexa488‐labeled probe BPMAG (5′‐TAAGGGGGTTTAAATCCTAC) were used.…”

Section: Methodsmentioning

confidence: 99%

A Novel Alveolate in Bivalves with Chemosynthetic Bacteria Inhabiting Deep‐Sea Methane Seeps

Noguchi

Kawato

Yoshida

et al. 2013

J Eukaryotic Microbiology

View full text Add to dashboard Cite

show abstract

“…The gill filaments of the P. okutanii specimens in which the organism in question was detected by PCR (sample no. H1773‐B1‐32 and H1773‐B1‐33) were used for FISH analyses, which were conducted as described previously (Fujinoki et al, 2012; Ikuta et al, 2018), with the following modifications. The fixed gills were embedded in paraffin and sliced into 10 μm transverse sections.…”

Section: Methodsmentioning

confidence: 99%

Molecular detection of a novel perkinsid associated with the deep‐sea clam Phreagena okutanii

Takishita

Ikuta

Komatsu

et al. 2022

J Eukaryotic Microbiology

View full text Add to dashboard Cite

Based on environmental DNA surveys, it is widely held that phylogenetically diverse protists exist in chemosynthetic ecosystems. However, knowledge regarding the protists associated with the endemic animals inhabiting these environments is still very limited. In the present study, utilizing polymerase chain reaction (PCR) techniques, we detected fragments of the small subunit ribosomal RNA (SSU rRNA) gene and the internal transcribed spacer (ITS) region of the ribosomal RNA genes from a particular protist in the gills of the vesicomyid clam Phreagena okutanii (formerly described as Calyptogena okutanii), a representative animal in chemosynthetic ecosystems. Based on the phylogeny of the SSU rRNA gene, the organism in question belongs to the genus Perkinsus, which is exclusively composed of protistan parasites infecting mollusks. Intriguingly, based on the ITS phylogeny, this protist was not related to any known Perkinsus species and was deeply branched within the radiation of this genus, thus represents an undescribed species. In addition, the protist detected by PCR was localized to the intercellular spaces in the gills of the host clam with fluorescence in situ hybridization. Although the ecological significance of this novel deep‐sea perkinsid remains unclear, our present findings may provide important insights into the diversity of the genus Perkinsus.

show abstract

Postembryonic development of the bone-eating worm Osedax japonicus

Miyamoto

Yamamoto

Yusa

et al. 2013

Naturwissenschaften

View full text Add to dashboard Cite

Bone-eating worms of the genus Osedax exclusively inhabit sunken vertebrate bones on the seafloor. The unique lifestyle and morphology of Osedax spp. have received much scientific attention, but the whole process of their development has not been observed. We herein report the postembryonic development and settlement of Osedax japonicus Fujikura et al. (Zool Sci 23:733-740, 2006). Fertilised eggs were spawned into the mucus of a female, and the larvae swam out from the mucus at the trochophore stage. Larvae survived for 10 days under laboratory conditions. The larvae settled on bones, elongated their bodies and crawled around on the bones. Then they secreted mucus to create a tube and the palps started to develop. The palps of O. japonicus arose from the prostomium, whereas the anterior appendages of other siboglinids arose from the peristomium. The recruitment of dwarf males was induced by rearing larvae with adult females. Females started to spawn eggs 6 weeks after settlement.

show abstract

Whole-mount fluorescence in situ hybridization to visualize symbiotic bacteria in the gills of deep‑sea mussels

Cited by 8 publications

References 12 publications

A Novel Alveolate in Bivalves with Chemosynthetic Bacteria Inhabiting Deep‐Sea Methane Seeps

A Novel Alveolate in Bivalves with Chemosynthetic Bacteria Inhabiting Deep‐Sea Methane Seeps

Molecular detection of a novel perkinsid associated with the deep‐sea clam Phreagena okutanii

Postembryonic development of the bone-eating worm Osedax japonicus

Contact Info

Product

Resources

About