White Spot Syndrome Virus Annexes a Shrimp STAT To Enhance Expression of the Immediate-Early Gene ie1

Yin Yang 1 (YY1) is a multifunctional zinc finger transcription factor that regulates many key cellular processes. In this study, we report the cloning of YY1 from Litopenaeus vannamei shrimp (LvYY1). This study shows that LvYY1 is ubiquitously expressed in shrimp tissues, and knockdown of LvYY1 expression by doublestranded RNA (dsRNA) injection in white spot syndrome virus (WSSV)-infected shrimp reduced both mRNA levels of the WSSV immediate early gene ie1 as well as overall copy numbers of the WSSV genome. The cumulative mortality rate of infected shrimp also declined with LvYY1 dsRNA injection. Using an insect cell model, we observed that LvYY1 activates ie1 expression, and a mutation introduced into the ie1 promoter subsequently repressed this capability. Moreover, reporter assay results suggested that LvYY1 is involved in basal transcriptional regulation via an interaction with L. vannamei TATA-binding protein (LvTBP). Electrophoretic mobility shift assay (EMSA) results further indicated that LvYY1 binds to a YY1-binding site in the region between positions Ϫ119 and Ϫ126 in the ie1 promoter. Chromatin immunoprecipitation analysis also confirmed that LvYY1 binds to the ie1 promoter in WSSVinfected shrimp. Taken together, these results indicate that WSSV uses host LvYY1 to enhance ie1 expression via a YY1-binding site and the TATA box in the ie1 promoter, thereby facilitating lytic activation and viral replication. IMPORTANCE WSSV has long been a scourge of the shrimp industry and remains a serious global threat. Thus, there is a pressing need to understand how the interactions between WSSV and its host drive infection, lytic development, pathogenesis, and mortality. Our successful cloning of L. vannamei YY1 (LvYY1) led to the elucidation of a critical virus-host interaction between LvYY1 and the WSSV immediate early gene ie1. We observed that LvYY1 regulates ie1 expression via a consensus YY1-binding site and TATA box. LvYY1 was also found to interact with L. vannamei TATAbinding protein (LvTBP), which may have an effect on basal transcription. Knockdown of LvYY1 expression inhibited ie1 transcription and subsequently reduced viral DNA replication and decreased cumulative mortality rates of WSSV-infected shrimp. These findings are expected to contribute to future studies involving WSSV-host interactions.

Section: Discussionsupporting

confidence: 54%

Role of Litopenaeus vannamei Yin Yang 1 in the Regulation of the White Spot Syndrome Virus Immediate Early Gene ie1

Huang

Cai

et al. 2017

“…Although the complete sequence of the WSSV genome has been known for several years (7,55,60), knowledge of the biological functions of the viral proteins is still quite poor. The WSSV immediate-early gene ie1 (31) was recently shown to use a shrimp signal transducer and activator of transcription (STAT) as a transcription factor to enhance its expression and contribute to its high promoter activity in host cells (30). In the present study, we further investigate the characteristics of WSSV IE1.…”

mentioning

confidence: 97%

“…Briefly, the Sf9 insect cells were seeded onto a 24-well plate (1 ϫ 10 5 cells/well) and grown in Sf-900 II serum-free medium (Invitrogen) overnight at 27°C. Cells were pWSSV-IE1 1-224 -V5-His IE1-F TCCCCGCGGATGGCCTTTAATTTTGAAGAC IE1-R TCCCCGCGGTACAAAGAATCCAGAAATCTCA pWSSV-GAL4-IE1 1-224 -V5-His IE1-F/IE1-R p35 BAS -Luc AcMNPV-p35-F1 CCGCTCGAGTGGCGACGGATTTTTATATACA AcMNPV-p35-R1 CCCAAGCTTTTTGCAATGGTAAAGCTCAAA G5p35 (30). The phRL/AcMNPVie1 plasmid contains the AcMNPV ie1 promoter to drive the expression of the Renilla luciferase gene and was used to monitor and normalize transfection efficiency.…”

Section: Plasmids (I) Luciferase Effectorsmentioning

confidence: 99%

“…In the present study, we further investigate the characteristics of WSSV IE1. This is made more difficult by the fact that no continuous shrimp cell line is currently available, and while bearing in mind that a heterologous system might introduce experimental artifacts, here we follow previous studies (22,30,34) and use the Sf9 insect cell system. Many viral immediate-early genes encode multifunctional transcriptional regulators that both positively and negatively modulate gene expression (26,52,57).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Transactivation, Dimerization, and DNA-Binding Activity of White Spot Syndrome Virus Immediate-Early Protein IE1

Liu

Chang

Wang

et al. 2008

Self Cite

Immediate-early proteins from many viruses function as transcriptional regulators and exhibit transactivation activity, DNA binding activity, and dimerization. In this study, we investigated these characteristics in white spot syndrome virus (WSSV) immediate-early protein 1 (IE1) and attempted to map the corresponding functional domains. Transactivation was investigated by transiently expressing a protein consisting of the DNA binding domain of the yeast transactivator GAL4 fused to full-length IE1. This GAL4-IE1 fusion protein successfully activated the Autographa californica multicapsid nucleopolyhedrovirus p35 basal promoter when five copies of the GAL4 DNA binding site were inserted upstream of the TATA box. A deletion series of GAL4-IE1 fusion proteins suggested that the transactivation domain of WSSV IE1 was carried within its first 80 amino acids. A point mutation assay further showed that all 12 of the acidic residues in this highly acidic domain were important for IE1's transactivation activity. DNA binding activity was confirmed by an electrophoresis mobility shift assay using a probe with 32 P-labeled random oligonucleotides. The DNA binding region of WSSV IE1 was located in its C-terminal end (amino acids 81 to 224), but mutation of a putative zinc finger motif in this C-terminal region suggested that this motif was not directly involved in the DNA binding activity. A homotypic interaction between IE1 molecules was demonstrated by glutathione S-transferase pull-down assay and a coimmunoprecipitation analysis. A glutaraldehyde cross-linking experiment and gel filtration analysis showed that this self-interaction led to the formation of stable IE1 dimers.White spot syndrome virus (WSSV) is the causative agent of a disease that has led to severe mortalities of cultured shrimps all over the world (10,14,23,53). WSSV is a large doublestranded DNA virus which is extremely virulent (23,38,39), has a wide host range (14, 33), and targets various tissues (32, 59). It was recently erected as the type species of genus Whispovirus in the family Nimaviridae (56). Although the complete sequence of the WSSV genome has been known for several years (7,55,60), knowledge of the biological functions of the viral proteins is still quite poor. The WSSV immediate-early gene ie1 (31) was recently shown to use a shrimp signal transducer and activator of transcription (STAT) as a transcription factor to enhance its expression and contribute to its high promoter activity in host cells (30). In the present study, we further investigate the characteristics of WSSV IE1. This is made more difficult by the fact that no continuous shrimp cell line is currently available, and while bearing in mind that a heterologous system might introduce experimental artifacts, here we follow previous studies (22,30,34) and use the Sf9 insect cell system. Many viral immediate-early genes encode multifunctional transcriptional regulators that both positively and negatively modulate gene expression (26,52,57). These transcriptional regulators must po...

“…However, the mechanism of the switch between WSSV immediate-early, early, and late gene expression is largely unknown, and only two studies (16,24) have reported on the promoters and regulatory sequences that might be involved. An analysis of WSSV gene expression profiles in shrimp tissue showed that 37 of the 64 early genes (58%) and 28 of the 58 late genes (48%) contain a consensus TATA box [TATA(A/T)A] 0 to 300 nucleotides (nt) upstream of the translational start codon (29).…”

mentioning

confidence: 99%

Penaeus monodon TATA Box-Binding Protein Interacts with the White Spot Syndrome Virus Transactivator IE1 and Promotes Its Transcriptional Activity

Liu

Chang

Huang

et al. 2011

Self Cite

We show here that the white spot syndrome virus (WSSV) immediate-early protein IE1 interacts with the Penaeus monodon TATA box-binding protein (PmTBP) and that this protein-protein interaction occurs in the absence of any other viral or cellular proteins or nucleic acids, both in vitro and in vivo. Mapping studies using enhanced green fluorescent protein (EGFP) fusion proteins containing truncations of IE1 and PmTBP delimited the interacting regions to amino acids (aa) 81 to 180 in IE1 and, except for aa 171 to 230, to aa 111 to 300 in PmTBP. A WSSV IE1 transactivation assay showed that large quantities (>800 ng) of the GAL4-IE1 plasmid caused "squelching" of the GAL4-IE1 activity and that this squelching effect was alleviated by the overexpression of PmTBP. Gene silencing of WSSV ie1 and PmTBP by pretreatment with double-stranded RNAs (dsRNAs) prior to WSSV challenge showed that the expression of these two target genes was specifically inhibited by their corresponding dsRNAs 72 and 96 h after dsRNA treatment. dsRNA silencing of ie1 and PmTBP expression also significantly reduced WSSV replication and the expression of the viral early gene dnapol (DNA polymerase gene). These results suggest that WSSV IE1 and PmTBP work cooperatively with each other during transcription initiation and, furthermore, that PmTBP is an important target for WSSV IE1's transactivation activity that can enhance viral gene expression and help in virus replication.White spot syndrome virus (WSSV), the type species of the genus Whispovirus, family Nimaviridae (42), has a wide host range and is a lethal agent infecting penaeid shrimp (35). WSSV has spread globally and has caused huge economic losses to the shrimp farming industry (10,27,28,35). WSSV is a large double-stranded DNA (dsDNA) virus (43), and although the complete sequence of the WSSV genome has been known for several years (7,40,45), knowledge of the biological functions of the viral proteins is still quite poor. During infection by large DNA viruses, such as baculoviruses and herpesviruses, gene expression is regulated such that the immediate-early (IE) genes are transcribed first, followed by the expression of the early and late genes (1,2,11,14). To date, 18 WSSV IE genes have been identified (20,25). Although the functions of most of the corresponding WSSV IE proteins have not yet been studied, many viral IE genes are known to encode multifunctional transcriptional regulators that both positively and negatively modulate viral early and late gene expression (17,37,44). Once expressed, the IE gene products may then function as regulatory trans-acting factors and may serve to initiate viral replicative events during infection. In the cascade of viral regulatory events, successive stages of virus replication are dependent on the proper expression of the genes in the preceding stage. Thus, viral IE genes are critically important in the virus infection cycle.Upon infection, expression of the WSSV genes can be divided into immediate-early, early, and late phases (25,29). However, th...