VRK1 functional insufficiency due to alterations in protein stability or kinase activity of human VRK1 pathogenic variants implicated in neuromotor syndromes

Martín-Doncel, Elena; Rojas, Ana M.; Cantarero, Lara; Lazo, Pedro A.

doi:10.1038/s41598-019-49821-7

Cited by 29 publications

(50 citation statements)

References 85 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Several of the known VRK1 mutants associated with neurological phenotypes also have a reduced protein stability 34 . Therefore, we tested the stability of p.Y213H compared to the normal VRK1 protein.…”

Section: Resultsmentioning

confidence: 99%

“…Human VRK1 was expressed from mammalian expression vector, pCEFL‐HA‐VRK1, 31 and bacterial expression pGEX‐4T‐VRK1 31–34 . The Y213H mutation was introduced in these plasmids with the GeneArt Site‐Directed Mutagenesis System (Invitrogen‐ThermoFisher).…”

Section: Patient Materials and Methodsmentioning

confidence: 99%

“…The primers for human VRK1‐p.Y213H were: forward (5′‐ AGGAGTTCATAAAGAACACAAAGAAGACCCCAAAA‐3′), and reverse (5′‐TTTTGGGGTCTTCTTTGTGTTCTTTATGAACTCCT‐3′). VRK1 wild‐type and the p.Y213H variant proteins were expressed in E.coli from constructs made in plasmid pGEX4T‐GST‐VRK1 for bacterial expression, 32 or in pCEFL‐HA‐VRK1 for expression in mammalian cells 34 . The human Y213H mutation was introduced in murine VRK1 (mVRK1) and cloned in pCEFL‐Myc‐mVRK1 to generate pCEFL‐Myc‐mVRK1(Y213H) plasmid.…”

Section: Patient Materials and Methodsmentioning

confidence: 99%

“…Kinase assays were performed as previously described 31,34,35 . Briefly, in vitro kinase assays with [ 32 ‐ P]‐γATP were performed with GST‐VRK1 wild‐type, or the p.Y213H variant 7,31,36 .…”

Section: Patient Materials and Methodsmentioning

confidence: 99%

“…All molecular and cellular methods have been reported before and are detailed in cellular and in Data S1 34 . Antibodies are in Table S1.…”

Section: Patient Materials and Methodsmentioning

confidence: 99%

See 4 more Smart Citations

VRK1 (Y213H) homozygous mutant impairs Cajal bodies in a hereditary case of distal motor neuropathy

Marcos¹,

Martín-Doncel

Morejón‐García

et al. 2020

Ann Clin Transl Neurol

Self Cite

View full text Add to dashboard Cite

Background Distal motor neuropathies with a genetic origin have a heterogeneous clinical presentation with overlapping features affecting distal nerves and including spinal muscular atrophies and amyotrophic lateral sclerosis. This indicates that their genetic background is heterogeneous. Patient and methods In this work, we have identified and characterized the genetic and molecular base of a patient with a distal sensorimotor neuropathy of unknown origin. For this study, we performed whole‐exome sequencing, molecular modelling, cloning and expression of mutant gene, and biochemical and cell biology analysis of the mutant protein. Results A novel homozygous recessive mutation in the human VRK1 gene, coding for a chromatin kinase, causing a substitution (c.637T > C; p.Tyr213His) in exon 8, was detected in a patient presenting since childhood a progressive distal sensorimotor neuropathy and spinal muscular atrophy syndrome, with normal intellectual development. Molecular modelling predicted this mutant VRK1 has altered the kinase activation loop by disrupting its interaction with the C‐terminal regulatory region. The p.Y213H mutant protein has a reduced kinase activity with different substrates, including histones H3 and H2AX, proteins involved in DNA damage responses, such as p53 and 53BP1, and coilin, the scaffold for Cajal bodies. The mutant VRK1(Y213H) protein is unable to rescue the formation of Cajal bodies assembled on coilin, in the absence of wild‐type VRK1. Conclusion The VRK1(Y213H) mutant protein alters the activation loop, impairs the kinase activity of VRK1 causing a functional insufficiency that impairs the formation of Cajal bodies assembled on coilin, a protein that regulates SMN1 and Cajal body formation.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Patient Materials and Methodsmentioning

confidence: 99%

Section: Patient Materials and Methodsmentioning

confidence: 99%

Section: Patient Materials and Methodsmentioning

confidence: 99%

“…All molecular and cellular methods have been reported before and are detailed in cellular and in Data S1 34 . Antibodies are in Table S1.…”

Section: Patient Materials and Methodsmentioning

confidence: 99%

See 3 more Smart Citations

VRK1 (Y213H) homozygous mutant impairs Cajal bodies in a hereditary case of distal motor neuropathy

Marcos¹,

Martín-Doncel

Morejón‐García

et al. 2020

Ann Clin Transl Neurol

Self Cite

View full text Add to dashboard Cite

show abstract

Phosphoserine aminotransferase deficiency diagnosed by whole‐exome sequencing and LC–MS/MS reanalysis: A case report and review of literature

Li,

Wei,

Sun

et al. 2024

Molec Gen & Gen Med

View full text Add to dashboard Cite

BackgroundPhosphoserine aminotransferase deficiency (PSATD) is an autosomal recessive disorder associated with hypertonia, psychomotor retardation, and acquired microcephaly. Patients with PSATD have low concentrations of serine in plasma and cerebrospinal fluid.MethodsWe reported a 2‐year‐old female child with developmental delay, dyskinesia, and microcephaly. LC–MS/MS was used to detect amino acid concentration in the blood and whole‐exome sequencing (WES) was used to identify the variants. PolyPhen‐2 web server and PyMol were used to predict the pathogenicity and changes in the 3D model molecular structure of protein caused by variants.ResultsWES demonstrated compound heterozygous variants in PSAT1, which is associated with PSATD, with a paternal likely pathogenic variant (c.235G>A, Gly79Arg) and a maternal likely pathogenic variant (c.43G>C, Ala15Pro). Reduced serine concentration in LC–MS/MS further confirmed the diagnosis of PSATD in this patient.ConclusionsOur findings demonstrate the importance of WES combined with LC–MS/MS reanalysis in the diagnosis of genetic diseases and expand the PSAT1 variant spectrum in PSATD. Moreover, we summarize all the cases caused by PSAT1 variants in the literature. This case provides a vital reference for the diagnosis of future cases.

show abstract

Pathogenic effects of Leu200Pro and Arg387His VRK1 protein variants on phosphorylation targets and H4K16 acetylation in distal hereditary motor neuropathy

Campos-Díaz,

Morejón-García,

Monte-Serrano

et al. 2024

J Mol Med

Self Cite

View full text Add to dashboard Cite

Rare recessive variants in the human VRK1 gene are associated with several motor neuron diseases (MND), such as amyotrophic lateral sclerosis, spinal muscular atrophy, or distal hereditary motor neuropathies (dHMN). A case with dHMN carrying two novel VRK1 gene variants, expressing Leu200Pro (L200P) and Arg387His (R387H) variant proteins, identified that these protein variants are functionally different. The Leu200Pro variant shares with several variants in the catalytic domain the loss of the kinase activity on different substrates, such as histones, p53, or coilin. However, the distal Arg387His variant and the distal Trp375* (W375X) chinese variant, both located at the end of the low complexity C-terminal region and proximal to the termination codon, retain their catalytic activity on some substrates, and mechanistically their functional impairment is different. The L200P variant, as well as most VRK1 pathogenic variants, impairs the phosphorylation of BAF and histone H4K16 acetylation, which are required for DNA attachment to the nuclear envelope and chromatin accessibility to DNA repair mechanisms, respectively. The R387H variant impairs phosphorylation of H2AX, an early step in different types of DNA damage responses. The functional variability of VRK1 protein variants and their different combinations are a likely contributor to the clinical phenotypic heterogeneity of motor neuron and neurological diseases associated with rare VRK1 pathogenic variants. Key messages VRK1 variants implicated in motor neuron diseases are functionally different. The L200P variant is kinase inactive, and the R387H variant is partially active. VRK1 variants alter H4K16 acetylation and loss of coilin and BAF phosphorylation. VRK1 variants alter Cajal bodies and DNA damage responses. VRK1 variant combination determines the neurological phenotype heterogeneity.

show abstract

VRK1 functional insufficiency due to alterations in protein stability or kinase activity of human VRK1 pathogenic variants implicated in neuromotor syndromes

Cited by 29 publications

References 85 publications

VRK1 (Y213H) homozygous mutant impairs Cajal bodies in a hereditary case of distal motor neuropathy

VRK1 (Y213H) homozygous mutant impairs Cajal bodies in a hereditary case of distal motor neuropathy

Phosphoserine aminotransferase deficiency diagnosed by whole‐exome sequencing and LC–MS/MS reanalysis: A case report and review of literature

Pathogenic effects of Leu200Pro and Arg387His VRK1 protein variants on phosphorylation targets and H4K16 acetylation in distal hereditary motor neuropathy

Contact Info

Product

Resources

About