Vitamin E inhibits CD95 ligand expression and protects T cells from activation-induced cell death

Li‐Weber, Min; Weigand, Markus A.; Giaisi, Marco; Süss, Dorothee; Treiber, M; Baumann, Sven; Ritsou, Elena; Breitkreutz, Raoul; Krammer, Peter H.

doi:10.1172/jci200215073

Cited by 13 publications

(8 citation statements)

References 42 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…cDNA samples were used as a template, and data were normalized for 18S (endogenous housekeeping gene) levels. The following primers were used for Fas and FasL mRNA detection: mouse Fas, 5′‐GAGGACTGCAAAATGAATGGGG‐3′ (forward) and 5′‐ACAACCATAGGCGATTTCTGGG‐3′ (reverse); mouse FasL, 5′‐CAGCAGTGCCACTTCATCTTGG‐3′ (forward) and 5′‐TTCACTCCAGAGATCAGAGCGG‐3′ (reverse) (33); human Fas, 5′‐ACTGTGACCCTTGCACCAAAT‐3′(forward) and 5′‐GCCACCCCAAGTTAGATCTGG‐3′ (reverse); human FasL, 5′‐AAAGTGGCCCATTTAACAGGC‐3′ (forward) and 5′‐AAAGCAGGACAATTCCATAGGTG‐3′ (reverse); and 18S, 5′‐GTAACCCGTTGAACCCCATT‐3′ (forward) and 5′‐CCATCCAATCGGTAGTAGCG‐3′ (reverse) (34, 35). PCR conditions were optimized for primers, templates, and MgCl 2 .…”

Section: Methodsmentioning

confidence: 99%

Adenosine A_2Areceptor activation protects CD4⁺T lymphocytes against activation‐induced cell death

et al. 2010

View full text Add to dashboard Cite

Activation-induced cell death (AICD) is initiated by T-cell receptor (TCR) restimulation of already activated and expanded peripheral T cells and is mediated through Fas/Fas ligand (FasL) interactions. Adenosine is a purine nucleoside signaling molecule, and its immunomodulatory effects are mediated by 4 G-protein-coupled receptors: A(1), A(2A), A(2B), and A(3). In this study, we investigated the role of A(2A) receptors in regulating CD4(+) T lymphocyte AICD. Our results showed that the selective A(2A) receptor agonist CGS21680 (EC(50)=15.2-32.6 nM) rescued mouse CD4(+) hybridomas and human Jurkat cells from AICD and that this effect was reversed by the selective A(2A) receptor antagonist ZM241385 (EC(50)=2.3 nM). CGS21680 decreased phosphatidylserine exposure on the membrane, as well as the cleavage of caspase-3, caspase-8 and poly(ADP-ribose) polymerase indicating that A(2A) receptor stimulation blocks the extrinsic apoptotic pathway. In addition, CGS21680 attenuated both Fas and FasL mRNA expression. This decrease in FasL expression was associated with decreased activation of the transcription factor systems NF-kappaB, NF-ATp, early growth response (Egr)-1, and Egr-3. The antiapoptotic effect of A(2A) receptor stimulation was mediated by protein kinase A. Together, these results demonstrate that A(2A) receptor activation suppresses the AICD of peripheral T cells.

show abstract

Section: Methodsmentioning

confidence: 99%

Adenosine A_2Areceptor activation protects CD4⁺T lymphocytes against activation‐induced cell death

et al. 2010

View full text Add to dashboard Cite

show abstract

“…Moreover, the proapoptotic molecules Fas and Fas ligand (FasL) undergo positive transcriptional regulation after exposure to oxidants [ 27 ]. Interestingly, Krammer and Colleagues demonstrated that in vitro administration of vitamin E suppresses FasL mRNA expression and protects T cells of HIV-1 infected individuals from Fas mediated apoptosis [ 28 ]. Moreover, it was demonstrated that administration of combinations of vitamin E and C to cultures of human umbilical vein endothelial cells (HUVEC) treated with lipopolysaccharide could prevent apoptosis by upregulation of Bcl-2 [ 29 ].…”

Section: Introductionmentioning

confidence: 99%

The role of antioxidant supplement in immune system, neoplastic, and neurodegenerative disorders: a point of view for an assessment of the risk/benefit profile

Brambilla

Mancuso

Scuderi

et al. 2008

Nutr J

119

View full text Add to dashboard Cite

This review will discuss some issues related to the risk/benefit profile of the use of dietary antioxidants. Thus, recent progress regarding the potential benefit of dietary antioxidants in the treatment of chronic diseases with a special focus on immune system and neurodegenerative disorders will be discussed here. It is well established that reactive oxygen species (ROS) play an important role in the etiology of numerous diseases, such as atherosclerosis, diabetes and cancer. Among the physiological defense system of the cell, the relevance of antioxidant molecules, such as glutathione and vitamins is quite well established. Recently, the interest of researchers has, for example, been conveyed on antioxidant enzyme systems, such as the heme oxygenase/biliverdin reductase system, which appears modulated by dietary antioxidant molecules, including polyphenols and beta-carotene. These systems possibly counteract oxidative damage very efficiently and finally modulate the activity of oxidative phenomena occurring, for instance, during pathophysiological processes. Although evidence shows that antioxidant treatment results in cytoprotection, the potential clinical benefit deriving from both nutritional and supplemental antioxidants is still under wide debate. In this line, the inappropriate assumption of some lipophylic vitamins has been associated with increased incidence of cancer rather than with beneficial effects.

show abstract

“…AKT, JNK, p38), and receptor activated MAP kinases involved in apoptosis (Bubici et al, 2006). Moreover, the proapoptotic molecules Fas and Fas ligand (FasL) undergo positive transcriptional regulation after exposure to oxidants (Weber et al, 2002). Interestingly, Krammer and Colleagues demonstrated that in vitro administration of vitamin E suppresses FasL mRNA expression and protects T cells of HIV-1 infected individuals from Fas mediated apoptosis (Haendeler et al, 1996).…”

Section: B-oxidative Stressmentioning

confidence: 99%

Potential mechanisms for the antioxidant effects of Jasonia montana

Hussein

2017

Scientific Journal of October 6 University

View full text Add to dashboard Cite

The use of medicinal plants as a dietary supplement is increasing in parallel with the research on it's therapeutically roles on human health. A literature survey indicated that polyphenols from Jasonia montana represent a promising antioxidant activity. Quercetin is the most common Jasonia montana polyphenols. Also, Jasonia montana quercetin derivatives act as antioxidants in vitro by scavenging reactive oxygen and nitrogen species and chelating redox-active transition metal ions. This review will discuss the mechanism of antioxidant and chelating activity of quercetin in an attempt to understand its mechanism of action, which may pave the way for possible therapeutic applications.

show abstract

Vitamin E inhibits CD95 ligand expression and protects T cells from activation-induced cell death

Cited by 13 publications

References 42 publications

Adenosine A_2Areceptor activation protects CD4⁺T lymphocytes against activation‐induced cell death

Adenosine A_2Areceptor activation protects CD4⁺T lymphocytes against activation‐induced cell death

The role of antioxidant supplement in immune system, neoplastic, and neurodegenerative disorders: a point of view for an assessment of the risk/benefit profile

Potential mechanisms for the antioxidant effects of Jasonia montana

Contact Info

Product

Resources

About

Vitamin E inhibits CD95 ligand expression and protects T cells from activation-induced cell death

Cited by 13 publications

References 42 publications

Adenosine A2Areceptor activation protects CD4+T lymphocytes against activation‐induced cell death

Adenosine A2Areceptor activation protects CD4+T lymphocytes against activation‐induced cell death

The role of antioxidant supplement in immune system, neoplastic, and neurodegenerative disorders: a point of view for an assessment of the risk/benefit profile

Potential mechanisms for the antioxidant effects of Jasonia montana

Contact Info

Product

Resources

About

Adenosine A_2Areceptor activation protects CD4⁺T lymphocytes against activation‐induced cell death

Adenosine A_2Areceptor activation protects CD4⁺T lymphocytes against activation‐induced cell death