Visualizing DNA folding and RNA in embryos at single-cell resolution

Mateo, Leslie J.; Murphy, Sedona E.; Hafner, Antonina; Cinquini, Isaac S.; Walker, Carly A.; Boettiger, Alistair N.

doi:10.1038/s41586-019-1035-4

Cited by 355 publications

(479 citation statements)

References 60 publications

Supporting

Mentioning

427

Contrasting

Unclassified

Order By: Relevance

“…Imaging approaches will be vital for this and the recent applications of electron microscopy tomography and super‐resolution microscopy to chromatin structure provide promising approaches. For example, a recent study used an array of oligonucleotide probes in DNA‐fluorescence in situ hybridization (DNA‐FISH) to trace the nanoscale DNA architecture at the bithorax complex in single cells in Drosophila embryos . The TAD organization is shown to vary in cells from different positions along the anterior–posterior axis of the embryo, corresponding to the different expression of the individual Hox genes in the bithorax complex.…”

Section: Discussionmentioning

confidence: 99%

Chromatin Architecture in the Fly: Living without CTCF/Cohesin Loop Extrusion?

Matthews

White

2019

BioEssays

View full text Add to dashboard Cite

The organization of the genome into topologically associated domains (TADs) appears to be a fundamental process occurring across a wide range of eukaryote organisms, and it likely plays an important role in providing an architectural foundation for gene regulation. Initial studies emphasized the remarkable parallels between TAD organization in organisms as diverse as Drosophila and mammals. However, whereas CCCTC‐binding factor (CTCF)/cohesin loop extrusion is emerging as a key mechanism for the formation of mammalian topological domains, the genome organization in Drosophila appears to depend primarily on the partitioning of chromatin state domains. Recent work suggesting a fundamental conserved role of chromatin state in building domain architecture is discussed and insights into genome organization from recent studies in Drosophila are considered.

show abstract

Section: Discussionmentioning

confidence: 99%

Chromatin Architecture in the Fly: Living without CTCF/Cohesin Loop Extrusion?

Matthews

White

2019

BioEssays

View full text Add to dashboard Cite

show abstract

“…We used an iterative immuno-FISH (fluorescence in situ hybridization) approach (Mateo et al, 2019) to investigate the organization of the chromosome loops associated with pairs of sister chromatids, both relative to each other and in relationship to the chromosome axis. Specifically, we sequentially detected and imaged pools of oligo-paint FISH probes representing ten consecutive 100 kbp regions spanning a 1 Mbp region of chromosome II on chromosomes prepared using partial spreading conditions.…”

Section: Evidence For Frequent Asymmetry Of Sister Chromatid Loopsmentioning

confidence: 99%

“…Probes were designed to target a 1 Mbp region on chromosome II, between coordinates 11,500,001-12,500,001, as in (Mateo et al 2019). The 1 Mbp region was divided into 100 10 kbp segments, and 100 probes were targeted to hybridize to each 10 kbp segment.…”

Section: Design and Generation Of Oligopaint Fish Probesmentioning

confidence: 99%

“…Each probe consisted of: 1) a unique non-overlapping 40-nt sequence corresponding to genomic DNA, 2) a 20-nt barcode sequence identifying each 10 kbp segment, 3) a 20-nt fiducial probe binding sequence (catcaacgccacgatcagct), and 4) a unique pair of index sequences at the 5' (ACGTCCGCCGCATCTACGAG) and 3' (CTGAACGGCGCACGTGTCTT) ends that allowed this probe set to be specifically amplified from a larger oligopool ordered from CustomArray. The probe set was synthesized from the oligopool as in (Mateo et al 2019), using forward primer (ACGTCCGCCGCATCTACGAG) and reverse primer (AAGACACGTGCGCCGTTCAG). Oligopaint probe sequences are provided in Supplementary Data File 1; read-out probe sequences and strand-displacement oligo sequences are provided in Supplementary Data Tables 1 and 2.…”

Section: Design and Generation Of Oligopaint Fish Probesmentioning

confidence: 99%

“…A fiducial probe, which labels the entire 1 Mbp region, was marked by Cy3. Sequential hybridization of readout and imaging oligos and probe displacement steps were performed as in (Mateo et al, 2019). At each hybridization step, widefield image stacks of mid-pachytene nuclei (in 50% Vectashield in 1xSCC) were acquired for all three channels.…”

Section: Sequential Immuno-fish Experimentsmentioning

confidence: 99%

See 2 more Smart Citations

Quantitative Cytogenetics Reveals Molecular Stoichiometry and Longitudinal Organization of Meiotic Chromosome Axes and Loops

Woglar

Yamaya

Roelens

et al. 2019

Preprint

View full text Add to dashboard Cite

During meiosis, chromosomes adopt a specialized organization involving assembly of a cohesin-based axis along their lengths, with DNA loops emanating from this axis. We applied novel, quantitative and widely applicable cytogenetic strategies to elucidate the molecular bases of this organization using C. elegans. Analyses of WT chromosomes and de novo circular mini-chromosomes revealed that meiosis-specific HORMA-domain proteins assemble into cohorts in defined numbers and co-organize the axis together with two functionally-distinct cohesin complexes (REC-8 and COH-3/4) in defined stoichiometry. We further found that REC-8 cohesins, which load during S phase and mediate sister chromatid cohesion, usually occur as individual complexes, supporting a model wherein sister cohesion is mediated locally by a single cohesin ring. REC-8 complexes are interspersed in an alternating pattern with cohorts of axis-organizing COH-3/4 complexes (averaging three per cohort), which are insufficient to confer cohesion but can bind to individual chromatids, suggesting a mechanism to enable formation of asymmetric sister chromatid loops. Indeed, immuno-FISH assays demonstrate frequent asymmetry in genomic content between the loops formed on sister chromatids. We discuss how features of chromosome axis/loop architecture inferred from our data can help to explain enigmatic, yet essential, aspects of the meiotic program.

show abstract

How chromosome topologies get their shape: views from proximity ligation and microscopy methods

2020

View full text Add to dashboard Cite

The 3D organization of our genome is an important determinant for the transcriptional output of a gene in (patho)physiological contexts. The spatial organization of linear chromosomes within nucleus is dominantly inferred using two distinct approaches, chromosome conformation capture (3C) and DNA fluorescent in situ hybridization (DNA–FISH). While 3C and its derivatives score genomic interaction frequencies based on proximity ligation events, DNA–FISH methods measure physical distances between genomic loci. Despite these approaches probe different characteristics of chromosomal topologies, they provide a coherent picture of how chromosomes are organized in higher‐order structures encompassing chromosome territories, compartments, and topologically associating domains. Yet, at the finer topological level of promoter–enhancer communication, the imaging‐centered and the 3C methods give more divergent and sometimes seemingly paradoxical results. Here, we compare and contrast observations made applying visual DNA–FISH and molecular 3C approaches. We emphasize that the 3C approach, due to its inherently competitive ligation step, measures only ‘relative’ proximities. A 3C interaction enriched between loci, therefore does not necessarily translates into a decrease in absolute spatial distance. Hence, we advocate caution when modeling chromosome conformations.

show abstract

Visualizing DNA folding and RNA in embryos at single-cell resolution

Cited by 355 publications

References 60 publications

Chromatin Architecture in the Fly: Living without CTCF/Cohesin Loop Extrusion?

Chromatin Architecture in the Fly: Living without CTCF/Cohesin Loop Extrusion?

Quantitative Cytogenetics Reveals Molecular Stoichiometry and Longitudinal Organization of Meiotic Chromosome Axes and Loops

How chromosome topologies get their shape: views from proximity ligation and microscopy methods

Contact Info

Product

Resources

About