Virus replication cycle of white spot syndrome virus in secondary cell cultures from the lymphoid organ of Litopenaeus vannamei

Abstract

The replication cycle of white spot syndrome virus (WSSV) was investigated in secondary cell cultures from the lymphoid organ of Litopenaeus vannamei. The secondary cells formed a confluent monolayer at 24 h post-reseeding, and this monolayer could be maintained for 10 days with a viability of 90 %. Binding of WSSV to cells reached a maximum (73¡3 % of cells and 4.84¡0.2 virus particles per virus-binding cell) at 120 min at 4 8C. WSSV entered cells by endocytosis. The co-localization of WSSV and early endosomes was observed starting from 30 min post-inoculation (p.i.). Double indirect immunofluorescence staining showed that all cell-bound WSSV particles entered these cells in the period between 0 and 60 min p.i. and that the uncoating of WSSV occurred in the same period. After 1 h inoculation at 27 8C, the WSSV nucleocapsid protein VP664 and envelope protein VP28 started to be synthesized in the cytoplasm from 1 and 3 h p.i., and were transported into nuclei from 3 and 6 h p.i., respectively. The percentage of cells that were VP664-and VP28-positive in their nuclei peaked (50¡4 %) at 12 h p.i. Quantitative PCR showed that WSSV DNA started to be synthesized from 6 h p.i. In vivo titration of the supernatants showed that the progeny WSSV were released from 12 h p.i. and peaked at 18 h p.i. In conclusion, the secondary cell cultures from the lymphoid organ were proven to be ideal for examination of the replication cycle of WSSV.

White spot syndrome virus entry is dependent on multiple endocytic routes and strongly facilitated by Cq-GABARAP in a CME-dependent manner

“…It is known that the hemocytes are originally developed in the Hpt and are finally released from this tissue into the blood circulation in crayfish 10 11 . Furthermore, a later study proposed a model of WSSV replication in primary cell cultures from the lymphoid organ of Litopenaeus vannamei , in which the viral replication cycle is approximately 12 h, and progeny virions are produced and released at the final stage of infection 12 . Together, these findings have advanced our understanding of WSSV infection.…”

Molecular Characterization of Viral Responsive Protein 15 and Its Possible Role in Nuclear Export of Virus in Black Tiger Shrimp Penaeus monodon

“…This suggested that silencing of Pm VRP15 caused an accumulation of WSSV DNA in nucleus. It was previously reported that WSSV DNA started to be synthesized from 6 hpi and the progeny WSSV were released from 12 hpi and peaked at 18 hpi 25 . It is possible that Pm VRP15 plays a role in viral exit from the nucleus, and that when Pm VRP15 was absent, the newly synthesized viral genomes accumulated in the nucleus.…”

“…Previously, Li et al . 25 proposed that the virus enters the cell via endocytosis and viral particle disassembly begins in the early endosome. The free nucleocapsid then injects the viral genome via a nuclear pore within the nucleus.…”

Kinetic analysis of internalization of white spot syndrome virus by haemocyte subpopulations of penaeid shrimp, Litopenaeus vannamei (Boone), and the outcome for virus and cell

“…This process resembles well the early stage of a WSSV infection of secondary cells of the lymphoid organ as earlier demonstrated by Li et al . (). However, the uptake of WSSV by haemocytes of penaeid shrimp did not result in efficient expression of new viral proteins.…”

“…Primers were designed in a conserved region of the VP19 coding sequence using the Primer3Plus website (Li et al . ). The VP19 DNA fragment was amplified in a 50 μL of polymerase chain reaction mixture using the primers designed previously in our laboratory (forward primer 5′‐ATTGGTATCCTCGTCCTGGC‐3′ and reverse primer 5′‐GTTATCGTTGGCAGTGTCGTC‐3′).…”