Virulence assessment of Australian Pyrenophora tritici‐repentis isolates

Abstract

The virulence of 57 Australian isolates of Pyrenophora tritici‐repentis (Ptr), a necrotrophic fungal pathogen responsible for the major wheat disease tan spot, was assessed through plant infection assays. Isolates collected from the northern, southern, and western wheat‐cropping regions of Australia were evaluated against 16 Australian bread wheat cultivars under controlled growth conditions. Following infection, the wheat panel displayed varying disease symptoms ranging from tiny necrotic specks to spreading chlorotic and necrotic lesions. Analysis of variance indicated that the wheat cultivar exhibited a greater effect on the disease response, explaining 62.7% of the variation, in comparison to the isolate (10.4%). The interaction between the cultivar and the isolate was statistically significant and was attributed to 9.8% of the total variation. All Ptr isolates examined were able to cause disease, but did not display a clear distinction in virulence on the wheat panel investigated, instead showing subtle differences in aggressiveness. Based on the disease responses, there was no obvious pattern between isolate aggressiveness and cropping region. Some cultivars, such as Hydra, exhibited an effective level of resistance in relation to the panel of isolates tested. All 57 Ptr isolates were found to possess the ToxA effector gene and lack the ToxB effector gene. The gene expression level of ToxA was up‐regulated at 3 days postinfection in both ToxA‐sensitive and ‐insensitive cultivars, independent of ToxA–Tsn1 recognition.

An international wheat diversity panel reveals novel sources of genetic resistance to tan spot in Australia

“…Similar to other crop diseases, it is also possible quantitative resistance is governed by many genes with small effects that are not associated with effector interactions (Cowger and Brown 2019). The universal non-significance of the Ptr ToxB covariate for all tan spot traits also aligns with previously reported studies on the lack of Ptr ToxB effector presence in Australian Ptr isolates (See et al 2021).…”

Profiling the Pyrenophora tritici‐repentis secretome: The Pf2 transcription factor regulates the secretion of the effector proteins ToxA and ToxB

“…For the gene expression analysis, total RNA from the inoculated leaves was extracted using TRIzol reagent (ThermoFisher Scientific) and cleaned up using Zymo‐Spin IC columns (Zymo Research). First‐strand cDNA synthesis and quantitative detection of ToxB expression relative to Actin were performed as described in See et al (2021) using the primer pair ToxB‐F 5′ CGAAGCGGTTATTGCGACTG 3′ and ToxB‐R 5′ ACTTTGCACACTCTCGCCAT 3′ to amplify the ToxB gene. Five biological replicates and two technical replicates were assayed per fungal strain.…”

Beneficial Microorganisms as Bioprotectants against Foliar Diseases of Cereals: A Review

“…According to Lamari and Strelkov [ 59 ], yield losses might be as high as 50%. In all of the main wheat-growing countries of Syria, Brazil, Argentina, Australia, Algeria, the United States, Russia, Canada, and a few other nations, the brown-black leaf spot is a common occurrence [ 57 , 60 , 61 ]. ToxA, ToxB, and ToxC are the three known effectors produced by tan spots of wheat [ 54 , 62 , 63 , 64 ].…”