Vimentin intermediate filaments control actin stress fiber assembly through GEF-H1 and RhoA

Jiu, Yaming; Peränen, Johan; Schaible, Niccole; Cheng, Fang; Eriksson, John E.; Krishnan, Ramaswamy; Lappalainen, Pekka

doi:10.1242/jcs.196881

Cited by 155 publications

(191 citation statements)

References 63 publications

Supporting

Mentioning

161

Contrasting

Order By: Relevance

“…Oligonucleotides for cloning guide RNA into pSpCas9 (BB)-2A-GFP vector (a gift from Feng Zhang, Addgene # 48138) were designed as described previously [42]. Forward primer: 5’ CACCG CTCATCACGCCTCGCCCTGT 3’ and reverse primer: 5’ AAAC ACAGGGCGAGGCGTGATGAG C 3’ (guide sequence underlined) for targeting exon 1.…”

Section: Star Methodsmentioning

confidence: 99%

“…The numbers and width of actin filaments bundles from cells plated on crossbow micro-patterns were analysed by the FilamentSensor software as described before [32]. The numbers of thin arcs and thick arcs were manually counted from leading edge of the cells plated on micro-pattern as previously described [42]. The manual quantification in this assay, as well as in the one presented in Figure 5 for the number of myosin II stacks, was blinded in the way that the person analysing the images was provided a randomized set of images for quantification.…”

Section: Star Methodsmentioning

confidence: 99%

“…To measure the contractile forces that cell exert upon their substrate, also called traction, we used traction force microscopy, as previously described [42]. In brief, both wild-type and myosin-18B knockout cells were cultured for 3–8 hours on custom made 35 mm dishes (Matrigen) with fibronectin- coated polyacrylamide gel (Young’s modulus = 25 kPa).…”

Section: Frapmentioning

confidence: 99%

See 2 more Smart Citations

Myosin-18B Promotes the Assembly of Myosin II Stacks for Maturation of Contractile Actomyosin Bundles

et al. 2019

Self Cite

View full text Add to dashboard Cite

SUMMARY Cell adhesion, morphogenesis, mechanosensing, and muscle contraction rely on contractile actomyosin bundles, where the force is produced through sliding of bipolar myosin II filaments along actin filaments. The assembly of contractile actomyosin bundles involves registered alignment of myosin II filaments and their subsequent fusion into large stacks. However, mechanisms underlying the assembly of myosin II stacks, and their physiological functions have remained elusive. Here we identified myosin-18B, an unconventional myosin, as a stable component of contractile stress fibers. Myosin-18B co-localized with myosin II motor domains in stress fibers, and was enriched at the ends of myosin II stacks. Importantly, myosin-18B deletion resulted in drastic defects in the concatenation and persistent association of myosin II filaments with each other, and thus led to severely impaired assembly of myosin II stacks. Consequently, lack of myosin-18B resulted in defective maturation of actomyosin bundles from their precursors in osteosarcoma cells. Moreover, myosin-18B knockout cells displayed abnormal morphogenesis, migration, and ability to exert forces to the environment. These results reveal a critical role for myosin-18B in myosin II stack assembly, and provide evidence that myosin II stacks are important for a variety of vital processes in cells.

show abstract

Section: Star Methodsmentioning

confidence: 99%

Section: Star Methodsmentioning

confidence: 99%

Section: Frapmentioning

confidence: 99%

See 1 more Smart Citation

Myosin-18B Promotes the Assembly of Myosin II Stacks for Maturation of Contractile Actomyosin Bundles

et al. 2019

Self Cite

View full text Add to dashboard Cite

show abstract

“…14 Moreover, vimentin interacts with the RAF-1/RhoA signaling pathway 15,16 to mediate actin dynamics and focal adhesion formation, 17 and vimentin depletion resulted in increased myosin light chain phosphorylation (MLC 20 ) and increased contractility in human osteosarcoma and human dermal fibroblasts. 18 Previous studies have demonstrated that JNK along with its substrate c-Jun is activated in response to mechanical stretch in rodent and human BSM cells. [19][20][21] In the current study, we transduced IF proteins into murine BSM strips via an adenovirus to examine the sufficiency of increased IF protein expression to reduce BSM contraction.…”

Section: Introductionmentioning

confidence: 98%

Increased expression of desmin and vimentin reduces bladder smooth muscle contractility via JNK2

et al. 2019

View full text Add to dashboard Cite

Bladder dysfunction is associated with the overexpression of the intermediate filament (IF) proteins desmin and vimentin in obstructed bladder smooth muscle (BSM). However, the mechanisms by which these proteins contribute to BSM dysfunction are not known. Previous studies have shown that desmin and vimentin directly participate in signal transduction. In this study, we hypothesized that BSM dysfunction associated with overexpression of desmin or vimentin is mediated via c‐Jun N‐terminal kinase (JNK). We employed a model of murine BSM tissue in which increased expression of desmin or vimentin was induced by adenoviral transduction to examine the sufficiency of increased IF protein expression to reduce BSM contraction. Murine BSM strips overexpressing desmin or vimentin generated less force in response to KCl and carbachol relative to the levels in control murine BSM strips, an effect associated with increased JNK2 phosphorylation and reduced myosin light chain (MLC20) phosphorylation. Furthermore, desmin and vimentin overexpressions did not alter BSM contractility and MLC20 phosphorylation in strips isolated from JNK2 knockout mice. Pharmacological JNK2 inhibition produced results qualitatively similar to those caused by JNK2 knockout. These findings suggest that inhibition of JNK2 may improve diminished BSM contractility associated with obstructive bladder disease.

show abstract

“…The in vitro studies that used green fluorescent protein (GFP)tagged vimentin (Jiu, 2017) and immunofluorescence studies of fixed cells (Prahlad, Yoon, Moir, Vale, & Goldman, 1998;) demonstrated that vimentin exists in cells as fragments of different lengths: short filaments (squiggles), long mature filaments, and nonfilamentous particles. Short ULF fragments with the average size of 130 nm were mainly localized close to small cell-matrix adhesions, while long IFs were found in the proximity of large focal adhesions (Terriac et al, 2017).…”

Section: Introductionmentioning

confidence: 99%

The role of vimentin in directional migration of rat fibroblasts

et al. 2019

View full text Add to dashboard Cite

Cell migration is one of the most important processes in which the cytoskeleton plays a main role. The cytoskeleton network is formed by tubulin microtubules, actin filaments, and intermediate filaments (IFs). While the structure and functions of the two aforementioned proteins have been extensively investigated during the last decades, vimentin IFs structure and their role in cell migration and adhesion remain unclear. Here, we investigated polarity determination in rat fibroblasts with either a knocked out vim gene or with a mutation that blocks filament formation on the stage of unit‐length filaments (ULFs). Structured illumination microscopy has demonstrated the difference in the morphology of IFs in wild‐type fibroblasts and of ULFs in mutant fibroblasts. We have developed an approach to measure cell stiffness separately on the trailing and leading edges using atomic force microscopy. Young's modulus values on the leading and trailing edge of migrating rat fibroblasts differ approximately by two times, being larger on the leading edge. The knockout of the vim gene leads to having comparable values of Young's moduli on both edges. Vimentin‐null cells change the direction of migration more frequently than those expressing wild‐type or mutated vimentin. Our results have shown the principle role of vimentin, not only in the form of IFs, but also as ULFs, in the determination of the polarity and the directionality of fibroblast migration.

show abstract

Vimentin intermediate filaments control actin stress fiber assembly through GEF-H1 and RhoA

Cited by 155 publications

References 63 publications

Myosin-18B Promotes the Assembly of Myosin II Stacks for Maturation of Contractile Actomyosin Bundles

Myosin-18B Promotes the Assembly of Myosin II Stacks for Maturation of Contractile Actomyosin Bundles

Increased expression of desmin and vimentin reduces bladder smooth muscle contractility via JNK2

The role of vimentin in directional migration of rat fibroblasts

Contact Info

Product

Resources

About