VHH characterization. Comparison of recombinant with chemically synthesized anti‐HER2 VHH

Abstract

In the continuous exploration of the VHH chemistry, biochemistry and therapeutic future use, we investigated two different production strategies of this small antibody‐like protein, using an anti‐HER2 VHH as a model. The total chemical synthesis of the 125 amino‐acid peptide was performed with reasonable yield, even if optimization will be necessary to upgrade this kind of production. In parallel, we expressed the same sequence in two different hosts: Escherichia coli and Pichia pastoris. Both productions were successful and led to a fair amount of VHHs. The integrity and conformation of the VHH were characterized by complementary mass spectrometry approaches, while surface plasmon resonance experiments were used to assess the VHH recognition capacity and affinity toward its “antigen.” Using this combination of orthogonal techniques, it was possible to show that the three VHHs—whether synthetic or recombinant ones—were properly and similarly folded and recognized the “antigen” HER2 with similar affinities, in the nanomolar range. This opens a route toward further exploration of modified VHH with unnatural amino acids and subsequently, VHH‐drug conjugates.

VHH characterization.Recombinant VHHs: Production, characterization and affinity

“…This opportunity would also facilitate the introduction of exotic amino acids that could be linked to cytotoxic compounds using alternative chemistry routes. We recently obtained the first synthetic anti-HER2 VHH [83], opening a route towards the possibility of using this approach to introduce orthogonal new chemistry to build armed VHHs. Too often as well, the practical evaluation of the characteristics of a given compound, such as innovative (bio)molecules is at first neglected.…”

The chemical synthesis of knob domain antibody fragments

“…There are several methods for incorporation of non-natural amino acids into antibody fragments or other small proteins, as part of attempts to either improve affinity, conjugate toxins for antibody drug conjugates 47 or to introduce chemical handles for photocoupling 48 . These primarily focus on either genetic codon expansion technology to permit incorporation of unnatural amino acids into the translational machinery of the host cell 49 , post translation bis-alkylation of cysteines to the non-natural amino acid Dha 50 , or complete solid-phase synthesis of proteins 11, 51 . While these solutions are elegant, they are restricted; genetic codon expansion can currently only change one residue at a time within a single-engineered expression system, while bis-alkylation of cysteines can only be used to introduce Dha.…”

“…While these solutions are elegant, they are restricted; genetic codon expansion can currently only change one residue at a time within a single-engineered expression system, while bis-alkylation of cysteines can only be used to introduce Dha. Chemical synthesis of proteins seems the most attractive option and has been used to produce a functional VHH fragment which bound HER2 11 . With established synthesis methods, this approach is suboptimal due to the inefficiency associated with solid-phase synthesis of long polypeptide chains.…”

“…Due to their size and structural complexity, recombinant antibody production is typically reliant on DNA engineering and mammalian or microbial cellular machinery. Conversely, A functional, full-length anti-HER2 VHH has been produced by solid-phase synthesis 11 . However, due to the inefficiency of performing solid-phase peptide synthesis on long polypeptide chains, this approach is exceptional.…”

Modular Conjugation of a Potent Anti-HER2 Immunotoxin Using Coassociating Peptides

“…Nano-HER2 DNA sequences described elsewhere 18 were amplified by PCR using HER2-For GATATACCATGGAAGTTCAACTGG and HER2-Rev ATGTGCACTAGTTGCGGCCGCAGAGCTAACCGTCACTTGGGTACC primers.…”