Vesicular Stomatitis Virus glycoprotein G carrying a tandem dimer of Foot and Mouth Disease Virus antigenic site A can be used as DNA and peptide vaccine for cattle

Capozzo, Alejandra Victoria; Wilda, Maximiliano; Bucafusco, Danilo; Lavoria, María de los Ángeles; Franco-Mahecha, Olga Lucía; Mansilla, Florencia Celeste; Pérez-Filgueira, Daniel Mariano; Grigera, Pablo R.

doi:10.1016/j.antiviral.2011.08.006

Cited by 8 publications

(10 citation statements)

References 61 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The sequence encoding for NcPRO was previously cloned into a pCI‐Neo vector (Promega, Madison, WI, USA) and fused downstream the 212 amino acid of VSV‐G, which was already cloned in pCDNA3.1 (VSV‐G∆212 ). A new forward primer with NcoI restriction site (5′‐GTGACCATGGACTGGGATCCCGTTGTCAAG‐3′) and a reverse primer with an XbaI site (5′‐GCTCTAGATCACTAATAGCCAGACTGGTGAAGG‐3′) were designed.…”

Section: Methodsmentioning

confidence: 99%

“…For that purpose, we fused NcPRO with the N‐terminal portion of the vesicular stomatitis virus glycoprotein G (VSV‐G) sequence, providing functional bovine T‐cell epitopes. We have demonstrated before that the association of short peptides to N‐terminal sequences of VSV‐G can enhance T‐cell responses to the third party antigen in bovines . The aim of this approach was to activate naïve T cells, which are difficult to tackle due to the highly variable bovine major histocompatibility complex (BoLA) …”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Fusion of foreign T‐cell epitopes and addition of TLR agonists enhance immunity against Neospora caninum profilin in cattle

Mansilla¹,

Quintana

Cardoso

et al. 2016

Parasite Immunology

View full text Add to dashboard Cite

We demonstrated recently that immunization with recombinant Neospora caninum profilin (rNcPRO) induces limited protection and a regulatory T-cell response in mice. The aim of this study was to evaluate the immune response elicited by rNcPRO in cattle and assess a strategy to enhance its immunogenicity, combining the addition of T-cell epitopes and immune modulators. We developed a chimeric recombinant profilin fused to functional T-cell epitopes present in the N-terminal sequence of vesicular stomatitis virus (VSV) glycoprotein G (rNcPRO/G). Groups of three cattle were immunized with two doses (2 weeks apart) of rNcPRO or rNcPRO/G formulated with alum hydroxide or a nanoparticulated soya-based adjuvant enriched with Toll-like receptor (TLR) 2 and TLR9 agonists, aimed to tackle the MyD88 pathway (AVECplus). rNcPRO induced only a primary immune response (IgM mediated), while antibodies in rNcPRO/G-vaccinated animals switched to IgG1 after the booster. The vaccine formulated with rNcPRO/G and AVECplus improved the production of systemic IFN-γ and induced long-term recall B-cell responses. Overall, our study provides data supporting the use of T-cell epitopes from VSV glycoprotein G and TLR agonists to enhance and modulate immunity to peptide antigens in bovines, particularly when using small proteins from parasites for which immune responses are usually feeble.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Fusion of foreign T‐cell epitopes and addition of TLR agonists enhance immunity against Neospora caninum profilin in cattle

Mansilla¹,

Quintana

Cardoso

et al. 2016

Parasite Immunology

View full text Add to dashboard Cite

show abstract

“…106 The antibody isotype, the avidity of the antibody to the virus in question, and the type of immune response elicited are also important factors to consider. [107][108][109] In a recent study comparing the accuracy of traditional and novel serological assays to predict cross-protection, it was found that the use of VNT titers and r 1 -values are inaccurate indicators of protection. 110 However, when the VNT titers were combined with the IgG1 titer, a more accurate estimate of FMD vaccine protection against the heterologous virus for serotype A was achieved.…”

mentioning

confidence: 99%

Challenges and prospects for the control of foot-and-mouth disease: an African perspective

Maree¹,

Kasanga²,

Scott³

et al. 2014

VMRR

View full text Add to dashboard Cite

Abstract:The epidemiology of foot-and-mouth disease (FMD) in Africa is unique in the sense that six of the seven serotypes of FMD viruses (Southern African Territories [SAT] 1, SAT2, SAT3, A, O, and C), with the exception of Asia-1, have occurred in the last decade. Due to underreporting of FMD, the current strains circulating throughout sub-Saharan Africa are in many cases unknown. For SAT1, SAT2, and serotype A viruses, the genetic diversity is reflected in antigenic variation, and indications are that vaccine strains may be needed for each topotype. This has serious implications for control using vaccines and for choice of strains to include in regional antigen banks. The epidemiology is further complicated by the fact that SAT1, SAT2, and SAT3 viruses are maintained and spread by wildlife, persistently infecting African buffalo in particular. Although the precise mechanism of transmission of FMD from buffalo to cattle is not well understood, it is facilitated by direct contact between these two species.Once cattle are infected they may maintain SAT infections without the further involvement of buffalo. No single strategy for control of FMD in Africa is applicable. Decision on the most effective regional control strategy should focus on an ecosystem approach, identification of primary endemic areas, animal husbandry practices, climate, and animal movement. Within each ecosystem, human behavior could be integrated in disease control planning. Different regions in sub-Saharan Africa are at different developmental stages and are thus facing unique challenges and priorities in terms of veterinary disease control. Many science-based options targeting improved vaccinology, diagnostics, and other control measures have been described. This review therefore aims to emphasize, on one hand, the progress that has been achieved in the development of new technologies, including research towards improved tailored vaccines, appropriate vaccine strain selection, vaccine potency, and diagnostics, and how it relates to the conditions in Africa. On the other hand, we focus on the unique epidemiological, ecological, livestock farming and marketing, socioeconomic, and governance issues that constrain effective FMD control. Any such new technologies should have the availability of safe livestock products for trade as the ultimate goal.

show abstract

“…Asimismo, desde hace muchos años se generan y aplican los avances en el estudio de los epitopes relevantes, en particular mediante el empleo de secuencias en tándem. Capozzo y colaboradores [162] obtuvieron buenos resultados al inmunizar ganado con vacunas a DNA y peptídicas producidas mediante el sistema BV-células de insecto. En ambos casos las vacunas contenían varias repeticiones del sitio A. Más recientemente se han desarrollado Discusión general vacunas a péptidos dendriméricos conteniendo epitopes B, cuyas respuestas fueron mejoradas por el agregado de epitopes T [181], [182].…”

Section: Discusión Generalunclassified

“…Teniendo en cuenta los resultados del capítulo I, en el que se determinó que los epitopes B generan la máxima respuesta humoral cuando son expuestos en alta densidad en toda la superficie del virión brotado, mientras que la mayor respuesta citotóxica generada contra epitopes T se logra mediante la presentación en cápside, el antígeno a ser transportado en la superficie del virión brotado contendrá los epitopes más relevantes ya descriptos y caracterizados en dicha cepa. Considerando también los antecedentes exitosos de expresión en tándem de sitios antigénicos[162], se diseñó un antígeno multiepitópico (AgME) que contiene tres copias del Sitio A (aa 14 a 160 de VP1), dos copias del Sitio C (aa 200 a 213 de VP1) y una copia de los de aa 41 a 60 de V P l.L a figura a continuación muestra un esquema del AgME cuya síntesis fue solicitada a IDT -Biodynamics. La secuencia nucleotídica y aminoacídica completa se encuentra en los anexos.…”

unclassified

Diseño racional de una vacuna recombinante contra el virus de la fiebre aftosa vectorizada e inmunomodulada por baculovirus

Tavarone¹

View full text Add to dashboard Cite

El presente proyecto tiene como objetivo diseñar de manera racional un candidato vacunal recombinante contra la fiebre aftosa basado en vectores báculo virales. Tiene como hipótesis que la localización de antígenos en diferentes posiciones de la partícula viral, en combinación con las propiedades antivirales, de presentación multimérica, de inmunomodulación y facilidad de producción biotecnológica del baculovirus ^cMNPV, redundarán en un efecto sinérgico, brindando sólidas respuestas inmunes humorales y celulares. Tiene como finalidad contribuir al control de enfermedades de interés veterinario empleando estrategias combinadas de presentación antigénica y antivirales. Para el diseño racional, en primer lugar definiremos las implicancias de la localización del antígeno en la partícula viral y la estrategia de presentación, así como el efecto de la formulación de los baculovirus recombinantes con diferentes adyuvantes de uso veterinario aprobado en los diferentes tipos de respuesta. Los resultados obtenidos empleando un antígeno modelo serán luego aplicados al diseño y evaluación de un BV recombinante que transporte antígenos específicos como candidato vacunal para FMDV-A/Arg/2001.

show abstract

Vesicular Stomatitis Virus glycoprotein G carrying a tandem dimer of Foot and Mouth Disease Virus antigenic site A can be used as DNA and peptide vaccine for cattle

Cited by 8 publications

References 61 publications

Fusion of foreign T‐cell epitopes and addition of TLR agonists enhance immunity against Neospora caninum profilin in cattle

Fusion of foreign T‐cell epitopes and addition of TLR agonists enhance immunity against Neospora caninum profilin in cattle

Challenges and prospects for the control of foot-and-mouth disease: an African perspective

Diseño racional de una vacuna recombinante contra el virus de la fiebre aftosa vectorizada e inmunomodulada por baculovirus

Contact Info

Product

Resources

About