Vector and parameters for targeted transgenic RNA interference in Drosophila melanogaster

Ni, Jian; Markstein, Michele; Binari, Richard; Pfeiffer, Barret D.; Liu, Lu Ping; Villalta, Christians; Booker, Matthew A.; Perkins, Lizabeth A.; Perrimon, Norbert

doi:10.1038/nmeth1146

Cited by 274 publications

(293 citation statements)

References 12 publications

(10 reference statements)

Supporting

Mentioning

283

Contrasting

Order By: Relevance

“…Based on our observation that cardiac deletion of MED13 confers an obese phenotype and that cardiac-specific overexpression of MED13 prevents obesity in mice (4), we examined whether muscle expression of MED13, encoded by skd, regulates fat accumulation in Drosophila. We performed RNAimediated knockdown experiments using the UAS/Gal4 system and expressed UAS-RNAi targeting skd mRNA with the Mef2-Gal4 driver, which directs the expression of UAS constructs in somatic, cardiac, and visceral muscle tissues (18)(19)(20)(21). By 3 wk of age, we observed increased abdominal fat bodies in adult Mef2>skd RNAi flies (Fig.…”

Section: Resultsmentioning

confidence: 96%

Heart- and muscle-derived signaling system dependent on MED13 and Wingless controls obesity in Drosophila

Lee

Bassel‐Duby

Olson

2014

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

Obesity develops in response to an imbalance of energy homeostasis and whole-body metabolism. Muscle plays a central role in the control of energy homeostasis through consumption of energy and signaling to adipose tissue. We reported previously that MED13, a subunit of the Mediator complex, acts in the heart to control obesity in mice. To further explore the generality and mechanistic basis of this observation, we investigated the potential influence of MED13 expression in heart and muscle on the susceptibility of Drosophila to obesity. Here, we show that heart/muscle-specific knockdown of MED13 or MED12, another Mediator subunit, increases susceptibility to obesity in adult flies. To identify possible muscle-secreted obesity regulators, we performed an RNAi-based genetic screen of 150 genes that encode secreted proteins and found that Wingless inhibition also caused obesity. Consistent with these findings, muscle-specific inhibition of Armadillo, the downstream transcriptional effector of the Wingless pathway, also evoked an obese phenotype in flies. Epistasis experiments further demonstrated that Wingless functions downstream of MED13 within a muscle-regulatory pathway. Together, these findings reveal an intertissue signaling system in which Wingless acts as an effector of MED13 in heart and muscle and suggest that Wingless-mediated cross-talk between striated muscle and adipose tissue controls obesity in Drosophila. This signaling system appears to represent an ancestral mechanism for the control of systemic energy homeostasis.O besity is a systemic disorder caused by an energy imbalance in which energy input exceeds energy utilization, resulting in accumulation of excess body fat. Muscle plays a central role in systemic energy homeostasis by consuming nutrients and signaling in an endocrine manner to other tissues (1-3). Thus, there has been intense interest in identifying secreted factors from muscle that modulate the function of adipose tissue.Previously, we reported that cardiac deletion of MED13, a subunit of the Mediator complex, increases susceptibility to obesity in mice whereas cardiac overexpression of MED13 confers a lean phenotype (4), revealing an unforeseen function of the heart as a systemic regulator of energy homeostasis. The Mediator is a conserved multisubunit complex that mediates the interaction between RNA polymerase II and transcription factors and therefore governs transcription in all eukaryotes (5). MED13 and MED12 are among four subunits of the auxiliary kinase module, which confers additional regulatory functions to the Mediator complex (6). Expression profiling of yeast mutants or gene-depleted Drosophila cell lines revealed a close correlation between the gene-expression programs controlled by MED13 and MED12, suggesting their concerted actions in gene regulation (7,8).Drosophila provides a powerful model system for the genetic analysis of obesity (9-11). The processes that regulate energy homeostasis, such as energy storage and mobilization of fat in adipose tissue of the fat bo...

show abstract

Section: Resultsmentioning

confidence: 96%

Heart- and muscle-derived signaling system dependent on MED13 and Wingless controls obesity in Drosophila

Lee

Bassel‐Duby

Olson

2014

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

show abstract

“…The Transgenic RNAi Project (TRiP) has generated and made publicly available a large number of transgenic RNAi fly stocks (Ni et al., 2008). In this resource, the transgenic shRNA is placed under UAS/GAL4 promoter and can be induced by feeding flies with the drug RU486 (Osterwalder, Yoon, White & Keshishian, 2001).…”

Section: Resultsmentioning

confidence: 99%

Comparative transcriptomics across 14 Drosophila species reveals signatures of longevity

Avanesov

Porter

et al. 2018

Aging Cell

View full text Add to dashboard Cite

SummaryLifespan varies dramatically among species, but the biological basis is not well understood. Previous studies in model organisms revealed the importance of nutrient sensing, mTOR, NAD/sirtuins, and insulin/IGF1 signaling in lifespan control. By studying life‐history traits and transcriptomes of 14 Drosophila species differing more than sixfold in lifespan, we explored expression divergence and identified genes and processes that correlate with longevity. These longevity signatures suggested that longer‐lived flies upregulate fatty acid metabolism, downregulate neuronal system development and activin signaling, and alter dynamics of RNA splicing. Interestingly, these gene expression patterns resembled those of flies under dietary restriction and several other lifespan‐extending interventions, although on the individual gene level, there was no significant overlap with genes previously reported to have lifespan‐extension effects. We experimentally tested the lifespan regulation potential of several candidate genes and found no consistent effects, suggesting that individual genes generally do not explain the observed longevity patterns. Instead, it appears that lifespan regulation across species is modulated by complex relationships at the system level represented by global gene expression.

show abstract

“…All flies were cultured on standard cornmeal food at 25°C. The {nos-Cas9}attP40 and {nos-Cas9}attP2 fly stocks were established according to a previously described protocol (30). In brief, nos-Cas9 was inserted into attP40 on the second chromosome or attP2 on the third chromosome by microinjection into y [1] 7]=CaryP}attP2 fly embryos, respectively, followed by screening for the CAGGAGCTATTAATTCGCGGAGG w1 sgRNA target site GAAGGGGGATTACTTCGCGGAGG w1 potential off-target site: Mo25 AGTGAAATAATAATTCGCGGGGG w1 potential off-target site: CG6428 GTTATCGGTTCAATTCGCGGTGG w1 potential off-target site: CTPsyn GAATATGTTTTAATTCGCGGCGG w1 potential off-target site: pyd (intron) CATCAATATTTAATTCGCGGGGG w1 potential off-target site: His2Av (intron) B TAGTTGGCCGCTCCCTGAACCGG w2 sgRNA target site TAGGCATCCAGTCCCTGAACCGG w2 potential off-target site: Nrg TGTTGGTATGTTCCCTGAACCGG w2 potential off-target site: Vm26Ac GGCTTTGAAGATCCCTGAACGGG w2 potential off-target site: CTPsyn TCTGGAACTTCTCCCTGAACAGG w2 potential off-target site: CG1907 GCGGCTGTAGCTCCCTGAACAGG w2 potential off-target site: fru (intron) A NGG:PAM N:mismatch Fig.…”

Section: Methodsmentioning

confidence: 99%

“…For sequencing analysis, genomic DNA from a single fly was used as template, and the defined DNA fragment was amplified by specific primers carrying EcoRI and XbaI (Table S2). The PCR products can be directly sequenced by one of the primers or cloned into the linearized VALIUM1 vector (30) by the same set of restriction enzymes, and then sequenced by specific primers (Table S2).…”

Section: Screening Of Mutationsmentioning

confidence: 99%

Optimized gene editing technology for Drosophila melanogaster using germ line-specific Cas9

Greenleaf

Sun

Housden

et al. 2013

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

376

402

View full text Add to dashboard Cite

The ability to engineer genomes in a specific, systematic, and costeffective way is critical for functional genomic studies. Recent advances using the CRISPR-associated single-guide RNA system (Cas9/sgRNA) illustrate the potential of this simple system for genome engineering in a number of organisms. Here we report an effective and inexpensive method for genome DNA editing in Drosophila melanogaster whereby plasmid DNAs encoding short sgRNAs under the control of the U6b promoter are injected into transgenic flies in which Cas9 is specifically expressed in the germ line via the nanos promoter. We evaluate the off-targets associated with the method and establish a Web-based resource, along with a searchable, genome-wide database of predicted sgRNAs appropriate for genome engineering in flies. Finally, we discuss the advantages of our method in comparison with other recently published approaches.nanos-Cas9 | HRMA M uch of our knowledge of the mechanisms underlying biological processes relies on genetic approaches, whereby gene activity is perturbed and the phenotypic consequences of perturbation are analyzed in detail. In recent years, several major advances have been made in the design of methods for specifically and efficiently perturbing genomes. Arguably, the most exciting advances rely on the ability to induce double-strand breaks (DSBs) by targeting a nuclease to a specific genomic sequence. Repair of DSBs by the error-prone nonhomologous endjoining (NHEJ) mechanism allows for the recovery of small deletions; moreover, repair of DSBs by homologous recombination (HR) in the presence of a donor template opens the door to a wide range of specifically engineered changes at the targeted site (1).Two nuclease-based systems, the zinc-finger nuclease (ZFN) and transcription activator-like effector nuclease (TALEN) systems, work effectively in a number of organisms (2-7). But because these approaches require the production of a construct encoding a unique DNA-binding protein fused to the nuclease domain, they can be both cumbersome and costly. In contrast, the recent approach based on the bacterial CRISPR-associated single-guide RNA (Cas9/sgRNA) system does not require production of specific fusion proteins for each targeted sequence (8-10).Cas9 was first identified in type II Streptococcus pyogenes as an RNA-guided defense system against invading viruses and plasmids (11-13). This adaptive immune-like system contains three components: CRISPR RNA (crRNA), trans-activating CRISPR RNA (tracrRNA), and Cas9. The tracrRNA triggers Cas9 nuclease activity and the crRNA guides Cas9 to cleave the specific foreign dsDNA sequence via base-pairing between the crRNA and the target DNA. Importantly, a single-guide RNA (sgRNA, also known as chiRNA), comprising the minimal crRNA and tracrRNA, can function similarly to the crRNA and tracrRNA, thereby providing a simplified method for genome editing (8)(9)(10)(14)(15)(16)(17)(18)(19)(20).Given the great promise of the Cas9/sgRNA method for genome engineering, we set out to test the sys...

show abstract

Vector and parameters for targeted transgenic RNA interference in Drosophila melanogaster

Cited by 274 publications

References 12 publications

Heart- and muscle-derived signaling system dependent on MED13 and Wingless controls obesity in Drosophila

Heart- and muscle-derived signaling system dependent on MED13 and Wingless controls obesity in Drosophila

Comparative transcriptomics across 14 Drosophila species reveals signatures of longevity

Optimized gene editing technology for Drosophila melanogaster using germ line-specific Cas9

Contact Info

Product

Resources

About