VDR gene expression in asthmatic children patients in relation to vitamin D status and supplementation

Ramadan, Abeer; Sallam, Sara F.; Elsheikh, Mai S.; Ishak, Sally Raafat; Abdelsayed, Marian G. R.; Salah, Maged; Nazih, Rasha; Khairat, Rabab; Ibrahim, Ola M.

doi:10.1016/j.genrep.2019.100387

Cited by 8 publications

(7 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…This was corroborated by Alyasin et al, and Whiting et al, who found that serum VitD levels were proven to be inversely correlated with asthma severity and that VitD levels and pulmonary function test (PFT) outcome had a direct and significant association [23], [24]. This is in line with a recent research of our group that showed a significant reduction of asthma symptoms and increase spirometry parameters when VitD was added to the asthma treatment [25]. However, these findings were limited by investigating solely vitamin D receptor expression.…”

Section: Discussionsupporting

confidence: 84%

Evaluation of IGF-1, TNF-α, and TGF-β Gene Expression after Oral Vitamin D Supplementation in School-Aged Children with Chronic Bronchial Asthma

Ramadan

Sallam²,

Yousef³

et al. 2022

Open Access Maced J Med Sci

Self Cite

View full text Add to dashboard Cite

BACKGROUND: Airway remodeling in children with bronchial asthma is due to the effect of inflammatory mediators and growth factors on the bronchial epithelium. Vitamin D (VitD) has immunomodulatory effect in many inflammatory diseases as bronchial asthma. The ant-inflammatory and anti-fibrotic role of VitD could prevent or improve air way remodeling in asthmatic patients. AIM: The study investigated the effect of VitD supplementation on the expression of transforming growth factor-beta (TGF-β), tumor necrosis factor-alpha (TNF-α), and insulin growth factor 1(IGF-1) and to correlate them with asthma severity and level of control. METHODS: The serum level of VitD and the mRNA expression of IGF-1, TGF-β, and TNF-α were estimated in 50 patients and 20 healthy controls control subjects using quantitative PCR in real-time. Asthmatic patients with VitD deficiency received VitD supplementation for 2 months followed by remeasurement of serum VitD and the genes expression TGF-β, TNF-α, and IGF-1. RESULT: Pre-intake of VitD and serum level of VitD were lower in all patients than control subjects (p = 0.005). VitD level was directly correlated with IGF-1 mRNA expression, which was indirectly correlated with TGF-β, r = 0.5 and −0.57; p = 0.0001 and 0.002, respectively. After VitD supplementation, the expression of the TGF-β mRNA gene was the only gene that decreased significantly (p = 0.04) together with improved asthma control and spirometric parameters. CONCLUSIONS: VitD supplementation down regulated the gene expression of TGF-β and improved asthma control level, but it did not significantly affect the gene expression of TNF-α and IGF-1.

show abstract

Section: Discussionsupporting

confidence: 84%

Evaluation of IGF-1, TNF-α, and TGF-β Gene Expression after Oral Vitamin D Supplementation in School-Aged Children with Chronic Bronchial Asthma

Ramadan

Sallam²,

Yousef³

et al. 2022

Open Access Maced J Med Sci

Self Cite

View full text Add to dashboard Cite

show abstract

“…ODIN Junior study on healthy white children aged 4-8 years (n 119) reported that a high-dose winter vitamin D 3 supplementation of 20 μg/d maintained the ability to produce calprotectin (S100A9) and LPS-induced IL-8 in healthy children, while low dose (10 μg/d) did not have an impact on innate immune markers (39) . In another study, a dose of 1000 μg/d oral cholecalciferol syrup significantly increased VDR mRNA expression in asthmatic Egyptian children (n 29) (40) . In addition, regular intake of vitamin D supplements among the asthmatic patients increased the serum 25OHD followed by a decrease of VDR mRNA expression (40,41) which was also observed in cancer (42) and multiple sclerosis patients (43,44) .…”

Section: Time and Dose-dependent Variation On Vitamin D Supplementati...mentioning

confidence: 91%

“…In another study, a dose of 1000 μg/d oral cholecalciferol syrup significantly increased VDR mRNA expression in asthmatic Egyptian children (n 29) (40) . In addition, regular intake of vitamin D supplements among the asthmatic patients increased the serum 25OHD followed by a decrease of VDR mRNA expression (40,41) which was also observed in cancer (42) and multiple sclerosis patients (43,44) . The plausible reason for the increase in 25OHD followed by a reduced VDR expression could be that 25OHD arbitrates the binding of VDR-retinoid X receptor to the promoter sequence of CYP24A1 gene that degrades 25OHD as a negative feedback mechanism (45) .…”

Section: Time and Dose-dependent Variation On Vitamin D Supplementati...mentioning

confidence: 91%

Vitamin D supplementation and immune-related markers: an update from nutrigenetic and nutrigenomic studies

Dhanapal

Vimaleswaran²

2022

Br J Nutr

View full text Add to dashboard Cite

Vitamin D is both a nutrient and a neurologic hormone that plays a critical role in modulating immune responses. While low levels of vitamin D are associated with increased susceptibility to infections and immune-related disorders, vitamin D supplementation has demonstrated immunomodulatory effects that can be protective against various diseases and infections. Vitamin D receptor is expressed in immune cells that have the ability to synthesise the active vitamin D metabolite. Thus, vitamin D acts in an autocrine manner in a local immunologic milieu in fighting against infections. Nutrigenetics and nutrigenomics are the new disciplines of nutritional science that explore the interaction between nutrients and genes using distinct approaches to decipher the mechanisms by which nutrients can influence disease development. Though molecular and observational studies have proved the immunomodulatory effects of vitamin D, only very few studies have documented the molecular insights of vitamin D supplementation. Until recently, researchers have investigated only a few selected genes involved in the vitamin D metabolic pathway that may influence the response to vitamin D supplementation and possibly disease risk. This review summarises the impact of vitamin D supplementation on immune markers from nutrigenetics and nutrigenomics perspective based on evidence collected through a structured search using PubMed, EMBASE, Science Direct and Web of Science. The research gaps and shortcomings from the existing data and future research direction of vitamin D supplementation on various immune-related disorders are discussed.

show abstract

“…VDR gene (Human ensemble gene ID: ENSG00000111424) gene expression detected by quantitative real‐time PCR was performed using a Bio‐Rad Cycler, Maxima SYBER Green Q PCR Master Mix, cDNA, and Forward primer 5′ CATGCATT TGTCTTTGTAATGTCAC‐3′ Reverse primer 5′‐AGGAGTTC CCCGAAGAAGG‐3′. Normalization was done based on the expression level of the internal control gene beta‐actin Forward primer 5′: TGTATGAAGGCTTTTGGTCTCC‐3′ Reverse primer 5′ CTGGTCTCAAGTCAGTGTACAGGT‐3′ 17 . The relative mRNA expression of the candidate gene is calculated by averaging the threshold cycle (Ct) numbers obtained from triplicate amplification reactions, and the magnitude of change in mRNA expression is determined using the standard 2 −(∆∆ct) method 18 …”

Section: Rna Extraction Gene Expressionmentioning

confidence: 99%

C‐reactive protein as a novel biomarker for vitamin D deficiency in alopecia areata

AbdElneam,

Al‐Dhubaibi,

Bahaj

et al. 2024

Skin Research and Technology

View full text Add to dashboard Cite

BackgroundAlopecia areata (AA) is an autoimmune condition characterized by sudden and unpredictable hair loss, with a lifetime incidence of 2%. AA can be divided into three categories: patchy alopecia, alopecia totalis, and alopecia universalis. It can affect a person's psychological health and overall quality of life. Elevated C‐reactive protein (CRP) levels in the liver may indicate an inflammatory response in autoimmune diseases. Vitamin D, essential for immune system control and skin health, may be related to AA. Hair follicles contain vitamin D receptors, which control immunological responses in the skin. However, no study has found a relationship between CRP and vitamin D in AA patients in our region.Subjects and MethodsAn analytical cross‐sectional study with a case‐control design research investigation of 82 AA patients and 81 healthy controls was carried out. Both groups’ medical histories were taken. Biochemical analysis was done for both groups as well as the serum vitamin D levels, and CRP. Genetic analysis for CDX2 rs11568820 variant detected by PCR (T‐ARMS‐PCR) method and vitamin D receptor (VDR) gene expression measured by real‐time PCR analysis for both patients and healthy subjects.ResultsCRP levels are higher in AA patients, AA patients with G/G genotypes exhibited higher concentrations of CRP when compared to those with A/A and A/G genotypes while patients with A/A genotypes have higher levels of Serum vitamin D as compared to the A/G and G/G genotypes. G allele was more abundant in AA patients. VDR gene expression was lower in AA compared to control and lower in ophiasis compared to localized and multiple patchy AA. An important inverse linear correlation was observed between vitamin D and CRP levels in ophiasis AA.ConclusionCRP concentrations were found to be elevated in AA patients. The considerable accuracy of CRP in the diagnosis of AA is substantiated by a statistically significant al. A noteworthy inverse linear association was observed between serum vitamin D and CRP concentrations in ophiasis AA.

show abstract

VDR gene expression in asthmatic children patients in relation to vitamin D status and supplementation

Cited by 8 publications

References 36 publications

Evaluation of IGF-1, TNF-α, and TGF-β Gene Expression after Oral Vitamin D Supplementation in School-Aged Children with Chronic Bronchial Asthma

Evaluation of IGF-1, TNF-α, and TGF-β Gene Expression after Oral Vitamin D Supplementation in School-Aged Children with Chronic Bronchial Asthma

Vitamin D supplementation and immune-related markers: an update from nutrigenetic and nutrigenomic studies

C‐reactive protein as a novel biomarker for vitamin D deficiency in alopecia areata

Contact Info

Product

Resources

About