Vasopressin receptor subtype 2 activation increases cell proliferation in the renal medulla of AQP1 null mice

Abstract

Aquaporin (AQP) 1 null mice have a defect in the renal concentrating gradient because of their inability to generate a hyperosmotic medullary interstitium. To determine the effect of vasopressin on renal medullary gene expression, in the absence of high local osmolarity, we infused 1-deamino-8-d-arginine vasopressin (dDAVP), a V(2) receptor (V(2)R)-specific agonist, in AQP1 null mice for 7 days. cDNA microarray analysis was performed on the renal medullary tissue, and 5,140 genes of the possible 12,000 genes on the array were included in the analysis. In the renal medulla of AQP1 null mice, 245 transcripts were identified as increased by dDAVP infusion and 200 transcripts as decreased (1.5-fold or more). Quantitative real-time PCR measurements confirmed the increases seen for cyclin D1, early growth response gene 1, and activating transcription factor 3, genes associated with changes in cell cycle/growth. Changes in mRNA expression were correlated with changes in protein expression by semiquantitative immunoblotting; cyclin D1 and ATF3 were increased significantly in abundance following dDAVP infusion in the renal medulla of AQP1 null mice (161 and 461%, respectively). A significant increase in proliferation of medullary collecting ducts cells, following V(2)R activation, was identified by proliferating cell nuclear antigen immunohistochemistry; colocalization studies with AQP2 indicated that the increase in proliferation was primarily observed in principal cells of the inner medullary collecting duct (IMCD). V(2)R activation, via dDAVP, increased AQP2 and AQP3 protein abundance in the cortical collecting ducts of AQP1 null mice. However, V(2)R activation did not increase AQP2 protein abundance in the IMCD of AQP1 null mice.

Phosphorylation of eIF2α via the general control kinase, GCN2, modulates the ability of renal medullary cells to survive high urea stress

“…RNA isolation, cDNA synthesis, and quantitative PCR were performed as previously described (4). Briefly, total RNA was isolated from mouse inner medullas using an RNeasy Mini Kit followed by cDNA synthesis.…”

Rapamycin inhibition of mTORC1 reverses lithium-induced proliferation of renal collecting duct cells

“…Kidney medullas were dissected and RNA was isolated using the Qiagen RNeasy Mini Kit (74104) according to the manufacturer's instructions and per our previous studies (6,24). A DNase (Qiagen, 79254) incubation was performed to remove potential DNA contamination.…”

“…Briefly, 2.5 g of RNA were reverse transcribed and resulting cDNA was diluted to 8 ng/l for real-time PCR which was performed on a RotorGene RG3000 (Qiagen, Valencia, CA). Primer sequences for c-Ret, c-Ret9, c-Ret51, cyclin D1, egr-1, and dynactin are previously published (6,20). Primer sequences for cyclooxygenase (COX)-2 were forward: ttaggctgttggaatttacgc, reverse: cttacagggccttcaaaatgtc.…”

Vasopressin-2 Receptor Signaling and Autosomal Dominant Polycystic Kidney Disease

“…Mice with a genetic deletion of the gene encoding for the water channel AQP1, which is predominantly expressed in the proximal nephron and essential for generating the countercurrent gradient by significantly increasing water permeability in the thin descending limb of Henle, 64 show an altered proliferation rate of tubular cells in response to vasopressin. 65 Furthermore, a recent phosphoproteomic study in vasopressinresponsive native tubular cells revealed that already short-term vasopressin leads to a slight decrease of cleaved caspases. 53 This study also confirmed decreased activity of MAPKs in response to vasopressin.…”