Various Novel Colistin Resistance Mechanisms Interact To Facilitate Adaptation of Aeromonas hydrophila to Complex Colistin Environments

Abstract

Aeromonas hydrophila , a heterotrophic and Gram-negative bacterium, has attracted considerable attention owing to the increasing prevalence of reported infections. Colistin is a last-resort antibiotic that can treat life-threatening infections caused by multidrug-resistant gram-negative bacteria. However, the mechanisms underlying colistin resistance in A. hydrophila remain unclear. The present study reveals four novel colistin resistance mechanisms in A. hydrophila : (i) EnvZ/OmpR upregulates the expression of the arnBCADTEF operon to mediate LPS modification by 4-amino-4-deoxy-L-arabinose; (ii) EnvZ/OmpR regulates the expression of the autotransporter gene 3832 to decrease outer membrane permeability in response to colistin; (iii) deletion of envZ/ompR activates PhoP/PhoQ, which functions as a substitute two-component system to mediate the addition of phosphoethanolamine to lipid A via pmrC; and (iv) the mlaF D173A mutant confers high-level colistin resistance via upregulation of the Mla pathway. The EnvZ/OmpR two-component system-mediated resistance mechanism is the leading form of colistin resistance in A. hydrophila , which enables it to rapidly generate low- to medium-level colistin resistance. As colistin concentrations in the environment continue to rise, antibiotic resistance mediated by EnvZ/OmpR becomes insufficient to ensure bacterial survival. Consequently, A. hydrophila has developed a mlaF mutation that results in high-level colistin resistance. Our findings indicate that A. hydrophila can thrive in a complex environment through various colistin resistance mechanisms.

Polymyxins, the last-resort antibiotics: Mode of action, resistance emergence, and potential solutions

“…Interestingly, polymyxin-resistant bacterial pathogens exhibit mutations in the genes encoding PhoPQ, PmrAB, and the operons they regulate, leading to their constitutive expression and LPS modification. There are hundreds of mutations documented in different organisms responsible for LPS modification leading to polymyxin resistance (Huang et al 2020 ; Liu et al 2021 ; Olaitan et al 2014 ; Poirel et al 2017a ).…”

“…However, with the indiscriminate use of polymyxins in aquaculture, resistance is increasingly being reported (Gonzalez-Avila et al 2021 ). In A. hydrophila , the primary way by which colistin resistance develops is by increased expression of the TCS EnvZ/OmpR that regulates the LPS modification pathway via the addition of L-Ara4N moiety to the lipid A (Liu et al 2021 ). It has also been observed that EnvZ/OmpR regulates the expression of an outer membrane protein (encoded by the gene 3832) which is predicted to be an autotransporter possibly involved in colistin uptake.…”

“…Another significant difference concerning A. hydrophila colistin resistance is that the TCS PhoPQ does not play a primary role in colistin resistance. However, in the absence of the EnvZ/OmpR, PhoPQ gets activated and modify the LPS via PEtN modification (Liu et al 2021 ). It remains to be discovered how EnvZ/OmpR system is connected to PhoPQ at the molecular level, though the existence of a protein connector between the two TCSs cannot be ruled out.…”

Hypothetical Protein gene1038 Contributes to Colistin Resistance in Aeromonas hydrophila

“…The expression of gene 1038 was significantly increased in the colistin-resistant strain 23-C-23 compared to that of the colistin-susceptible strain WCX23 ( Fig. 1A ) via quantitative reverse transcription-PCR (RT-PCR) using the primers gene 1038 -F (5′- GCTGCTTCGGCTTCCTCTAT -3′) and gene 1038 -R (5′- GGTCTCGCCGAACATGAGAT -3′) as previously described ( 4 ). This suggests that gene 1038 might be associated with colistin resistance in A. hydrophila .…”

“…This suggests that gene 1038 might be associated with colistin resistance in A. hydrophila . To test this hypothesis, gene 1038 was knocked out in a 23-C-23 background (23-C-23:Δgene 1038 ) and subsequently restored in complemented strain 23-C-23:CΔgene 1038 , as previously described ( 4 ) (see Table S1 in the supplemental material). The results showed that the colistin MIC for 23-C-23:Δgene 1038 was 8-fold lower than for the parent strain and that the complementation of gene 1038 in 23-C-23:CΔgene 1038 restored resistance to colistin ( Table 1 ).…”